ID: 1084815391

View in Genome Browser
Species Human (GRCh38)
Location 11:71642843-71642865
Sequence GGAAAGAAAAGTCTCTCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084815387_1084815391 -4 Left 1084815387 11:71642824-71642846 CCCACAGCTCCTCCTGGAGGGAA No data
Right 1084815391 11:71642843-71642865 GGAAAGAAAAGTCTCTCCTTAGG No data
1084815388_1084815391 -5 Left 1084815388 11:71642825-71642847 CCACAGCTCCTCCTGGAGGGAAA No data
Right 1084815391 11:71642843-71642865 GGAAAGAAAAGTCTCTCCTTAGG No data
1084815383_1084815391 11 Left 1084815383 11:71642809-71642831 CCAGGGTGTGTCTGACCCACAGC No data
Right 1084815391 11:71642843-71642865 GGAAAGAAAAGTCTCTCCTTAGG No data
1084815382_1084815391 12 Left 1084815382 11:71642808-71642830 CCCAGGGTGTGTCTGACCCACAG No data
Right 1084815391 11:71642843-71642865 GGAAAGAAAAGTCTCTCCTTAGG No data
1084815381_1084815391 27 Left 1084815381 11:71642793-71642815 CCGCTTGTGAATGATCCCAGGGT No data
Right 1084815391 11:71642843-71642865 GGAAAGAAAAGTCTCTCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084815391 Original CRISPR GGAAAGAAAAGTCTCTCCTT AGG Intergenic
No off target data available for this crispr