ID: 1084815392

View in Genome Browser
Species Human (GRCh38)
Location 11:71642850-71642872
Sequence AAAGTCTCTCCTTAGGTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084815389_1084815392 -6 Left 1084815389 11:71642833-71642855 CCTCCTGGAGGGAAAGAAAAGTC No data
Right 1084815392 11:71642850-71642872 AAAGTCTCTCCTTAGGTATTTGG No data
1084815383_1084815392 18 Left 1084815383 11:71642809-71642831 CCAGGGTGTGTCTGACCCACAGC No data
Right 1084815392 11:71642850-71642872 AAAGTCTCTCCTTAGGTATTTGG No data
1084815382_1084815392 19 Left 1084815382 11:71642808-71642830 CCCAGGGTGTGTCTGACCCACAG No data
Right 1084815392 11:71642850-71642872 AAAGTCTCTCCTTAGGTATTTGG No data
1084815387_1084815392 3 Left 1084815387 11:71642824-71642846 CCCACAGCTCCTCCTGGAGGGAA No data
Right 1084815392 11:71642850-71642872 AAAGTCTCTCCTTAGGTATTTGG No data
1084815390_1084815392 -9 Left 1084815390 11:71642836-71642858 CCTGGAGGGAAAGAAAAGTCTCT No data
Right 1084815392 11:71642850-71642872 AAAGTCTCTCCTTAGGTATTTGG No data
1084815388_1084815392 2 Left 1084815388 11:71642825-71642847 CCACAGCTCCTCCTGGAGGGAAA No data
Right 1084815392 11:71642850-71642872 AAAGTCTCTCCTTAGGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084815392 Original CRISPR AAAGTCTCTCCTTAGGTATT TGG Intergenic
No off target data available for this crispr