ID: 1084816519

View in Genome Browser
Species Human (GRCh38)
Location 11:71650527-71650549
Sequence TCTGCACCCTGGTGTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084816513_1084816519 2 Left 1084816513 11:71650502-71650524 CCTCTCTTTCTTTTACTCACACC No data
Right 1084816519 11:71650527-71650549 TCTGCACCCTGGTGTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084816519 Original CRISPR TCTGCACCCTGGTGTCCTGG GGG Intergenic
No off target data available for this crispr