ID: 1084822287

View in Genome Browser
Species Human (GRCh38)
Location 11:71700602-71700624
Sequence GGCTGTGTTAGGGCATTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084822287_1084822300 28 Left 1084822287 11:71700602-71700624 CCCCAAAATGCCCTAACACAGCC No data
Right 1084822300 11:71700653-71700675 CTCACTGTGGCCAGGCATGGTGG No data
1084822287_1084822297 20 Left 1084822287 11:71700602-71700624 CCCCAAAATGCCCTAACACAGCC No data
Right 1084822297 11:71700645-71700667 GAATAAGCCTCACTGTGGCCAGG No data
1084822287_1084822295 15 Left 1084822287 11:71700602-71700624 CCCCAAAATGCCCTAACACAGCC No data
Right 1084822295 11:71700640-71700662 ACCAAGAATAAGCCTCACTGTGG No data
1084822287_1084822298 25 Left 1084822287 11:71700602-71700624 CCCCAAAATGCCCTAACACAGCC No data
Right 1084822298 11:71700650-71700672 AGCCTCACTGTGGCCAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084822287 Original CRISPR GGCTGTGTTAGGGCATTTTG GGG (reversed) Intergenic
No off target data available for this crispr