ID: 1084826252

View in Genome Browser
Species Human (GRCh38)
Location 11:71733822-71733844
Sequence ACTGTGGGCAGCCCCGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084826252_1084826256 -4 Left 1084826252 11:71733822-71733844 CCATCTGCGGGGCTGCCCACAGT No data
Right 1084826256 11:71733841-71733863 CAGTACATGGACCCCCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084826252 Original CRISPR ACTGTGGGCAGCCCCGCAGA TGG (reversed) Intergenic