ID: 1084827955

View in Genome Browser
Species Human (GRCh38)
Location 11:71745412-71745434
Sequence AAGAGCCTATTGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084827951_1084827955 8 Left 1084827951 11:71745381-71745403 CCTTCAGGTGCGTGGAGCATTAT No data
Right 1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG No data
1084827950_1084827955 9 Left 1084827950 11:71745380-71745402 CCCTTCAGGTGCGTGGAGCATTA No data
Right 1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG No data
1084827948_1084827955 18 Left 1084827948 11:71745371-71745393 CCTTTTCAACCCTTCAGGTGCGT No data
Right 1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084827955 Original CRISPR AAGAGCCTATTGAACTCTGG GGG Intergenic
No off target data available for this crispr