ID: 1084829511

View in Genome Browser
Species Human (GRCh38)
Location 11:71758101-71758123
Sequence TTAAGGTCCATTGTGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084829511_1084829518 8 Left 1084829511 11:71758101-71758123 CCATCCTTCACAATGGACCTTAA No data
Right 1084829518 11:71758132-71758154 CCTCCTGGTGTTATTCATTGTGG No data
1084829511_1084829513 -7 Left 1084829511 11:71758101-71758123 CCATCCTTCACAATGGACCTTAA No data
Right 1084829513 11:71758117-71758139 ACCTTAATATTCCCACCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084829511 Original CRISPR TTAAGGTCCATTGTGAAGGA TGG (reversed) Intergenic
No off target data available for this crispr