ID: 1084829512

View in Genome Browser
Species Human (GRCh38)
Location 11:71758105-71758127
Sequence AATATTAAGGTCCATTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084829512_1084829518 4 Left 1084829512 11:71758105-71758127 CCTTCACAATGGACCTTAATATT No data
Right 1084829518 11:71758132-71758154 CCTCCTGGTGTTATTCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084829512 Original CRISPR AATATTAAGGTCCATTGTGA AGG (reversed) Intergenic
No off target data available for this crispr