ID: 1084829514

View in Genome Browser
Species Human (GRCh38)
Location 11:71758118-71758140
Sequence ACCAGGAGGTGGGAATATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084829514_1084829522 24 Left 1084829514 11:71758118-71758140 CCTTAATATTCCCACCTCCTGGT No data
Right 1084829522 11:71758165-71758187 AGCTAGTCCTCAATTGGGTCTGG No data
1084829514_1084829521 19 Left 1084829514 11:71758118-71758140 CCTTAATATTCCCACCTCCTGGT No data
Right 1084829521 11:71758160-71758182 GTCTTAGCTAGTCCTCAATTGGG No data
1084829514_1084829520 18 Left 1084829514 11:71758118-71758140 CCTTAATATTCCCACCTCCTGGT No data
Right 1084829520 11:71758159-71758181 TGTCTTAGCTAGTCCTCAATTGG No data
1084829514_1084829518 -9 Left 1084829514 11:71758118-71758140 CCTTAATATTCCCACCTCCTGGT No data
Right 1084829518 11:71758132-71758154 CCTCCTGGTGTTATTCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084829514 Original CRISPR ACCAGGAGGTGGGAATATTA AGG (reversed) Intergenic
No off target data available for this crispr