ID: 1084829518

View in Genome Browser
Species Human (GRCh38)
Location 11:71758132-71758154
Sequence CCTCCTGGTGTTATTCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084829512_1084829518 4 Left 1084829512 11:71758105-71758127 CCTTCACAATGGACCTTAATATT No data
Right 1084829518 11:71758132-71758154 CCTCCTGGTGTTATTCATTGTGG No data
1084829511_1084829518 8 Left 1084829511 11:71758101-71758123 CCATCCTTCACAATGGACCTTAA No data
Right 1084829518 11:71758132-71758154 CCTCCTGGTGTTATTCATTGTGG No data
1084829514_1084829518 -9 Left 1084829514 11:71758118-71758140 CCTTAATATTCCCACCTCCTGGT No data
Right 1084829518 11:71758132-71758154 CCTCCTGGTGTTATTCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084829518 Original CRISPR CCTCCTGGTGTTATTCATTG TGG Intergenic
No off target data available for this crispr