ID: 1084829809

View in Genome Browser
Species Human (GRCh38)
Location 11:71760230-71760252
Sequence TGAATGGGGGAGTAGTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084829809_1084829818 22 Left 1084829809 11:71760230-71760252 CCACCTCACTACTCCCCCATTCA No data
Right 1084829818 11:71760275-71760297 TCCAAACTCATCTACACTTTAGG No data
1084829809_1084829815 -3 Left 1084829809 11:71760230-71760252 CCACCTCACTACTCCCCCATTCA No data
Right 1084829815 11:71760250-71760272 TCAAGTGTGCCTTCCATGTGTGG No data
1084829809_1084829820 23 Left 1084829809 11:71760230-71760252 CCACCTCACTACTCCCCCATTCA No data
Right 1084829820 11:71760276-71760298 CCAAACTCATCTACACTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084829809 Original CRISPR TGAATGGGGGAGTAGTGAGG TGG (reversed) Intergenic
No off target data available for this crispr