ID: 1084829815

View in Genome Browser
Species Human (GRCh38)
Location 11:71760250-71760272
Sequence TCAAGTGTGCCTTCCATGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084829805_1084829815 23 Left 1084829805 11:71760204-71760226 CCTGGGTTCTGGCCGGCTAGCCC No data
Right 1084829815 11:71760250-71760272 TCAAGTGTGCCTTCCATGTGTGG No data
1084829804_1084829815 24 Left 1084829804 11:71760203-71760225 CCCTGGGTTCTGGCCGGCTAGCC No data
Right 1084829815 11:71760250-71760272 TCAAGTGTGCCTTCCATGTGTGG No data
1084829810_1084829815 -6 Left 1084829810 11:71760233-71760255 CCTCACTACTCCCCCATTCAAGT No data
Right 1084829815 11:71760250-71760272 TCAAGTGTGCCTTCCATGTGTGG No data
1084829807_1084829815 3 Left 1084829807 11:71760224-71760246 CCCATGCCACCTCACTACTCCCC No data
Right 1084829815 11:71760250-71760272 TCAAGTGTGCCTTCCATGTGTGG No data
1084829806_1084829815 11 Left 1084829806 11:71760216-71760238 CCGGCTAGCCCATGCCACCTCAC No data
Right 1084829815 11:71760250-71760272 TCAAGTGTGCCTTCCATGTGTGG No data
1084829809_1084829815 -3 Left 1084829809 11:71760230-71760252 CCACCTCACTACTCCCCCATTCA No data
Right 1084829815 11:71760250-71760272 TCAAGTGTGCCTTCCATGTGTGG No data
1084829801_1084829815 29 Left 1084829801 11:71760198-71760220 CCCACCCCTGGGTTCTGGCCGGC No data
Right 1084829815 11:71760250-71760272 TCAAGTGTGCCTTCCATGTGTGG No data
1084829802_1084829815 28 Left 1084829802 11:71760199-71760221 CCACCCCTGGGTTCTGGCCGGCT No data
Right 1084829815 11:71760250-71760272 TCAAGTGTGCCTTCCATGTGTGG No data
1084829803_1084829815 25 Left 1084829803 11:71760202-71760224 CCCCTGGGTTCTGGCCGGCTAGC No data
Right 1084829815 11:71760250-71760272 TCAAGTGTGCCTTCCATGTGTGG No data
1084829799_1084829815 30 Left 1084829799 11:71760197-71760219 CCCCACCCCTGGGTTCTGGCCGG No data
Right 1084829815 11:71760250-71760272 TCAAGTGTGCCTTCCATGTGTGG No data
1084829808_1084829815 2 Left 1084829808 11:71760225-71760247 CCATGCCACCTCACTACTCCCCC No data
Right 1084829815 11:71760250-71760272 TCAAGTGTGCCTTCCATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084829815 Original CRISPR TCAAGTGTGCCTTCCATGTG TGG Intergenic
No off target data available for this crispr