ID: 1084829818

View in Genome Browser
Species Human (GRCh38)
Location 11:71760275-71760297
Sequence TCCAAACTCATCTACACTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084829811_1084829818 9 Left 1084829811 11:71760243-71760265 CCCCCATTCAAGTGTGCCTTCCA No data
Right 1084829818 11:71760275-71760297 TCCAAACTCATCTACACTTTAGG No data
1084829816_1084829818 -7 Left 1084829816 11:71760259-71760281 CCTTCCATGTGTGGTTTCCAAAC No data
Right 1084829818 11:71760275-71760297 TCCAAACTCATCTACACTTTAGG No data
1084829808_1084829818 27 Left 1084829808 11:71760225-71760247 CCATGCCACCTCACTACTCCCCC No data
Right 1084829818 11:71760275-71760297 TCCAAACTCATCTACACTTTAGG No data
1084829807_1084829818 28 Left 1084829807 11:71760224-71760246 CCCATGCCACCTCACTACTCCCC No data
Right 1084829818 11:71760275-71760297 TCCAAACTCATCTACACTTTAGG No data
1084829812_1084829818 8 Left 1084829812 11:71760244-71760266 CCCCATTCAAGTGTGCCTTCCAT No data
Right 1084829818 11:71760275-71760297 TCCAAACTCATCTACACTTTAGG No data
1084829810_1084829818 19 Left 1084829810 11:71760233-71760255 CCTCACTACTCCCCCATTCAAGT No data
Right 1084829818 11:71760275-71760297 TCCAAACTCATCTACACTTTAGG No data
1084829813_1084829818 7 Left 1084829813 11:71760245-71760267 CCCATTCAAGTGTGCCTTCCATG No data
Right 1084829818 11:71760275-71760297 TCCAAACTCATCTACACTTTAGG No data
1084829809_1084829818 22 Left 1084829809 11:71760230-71760252 CCACCTCACTACTCCCCCATTCA No data
Right 1084829818 11:71760275-71760297 TCCAAACTCATCTACACTTTAGG No data
1084829814_1084829818 6 Left 1084829814 11:71760246-71760268 CCATTCAAGTGTGCCTTCCATGT No data
Right 1084829818 11:71760275-71760297 TCCAAACTCATCTACACTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084829818 Original CRISPR TCCAAACTCATCTACACTTT AGG Intergenic
No off target data available for this crispr