ID: 1084833634

View in Genome Browser
Species Human (GRCh38)
Location 11:71787538-71787560
Sequence TGGCGCCCGAGGAGAACGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 6, 1: 4, 2: 0, 3: 3, 4: 48}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084833621_1084833634 7 Left 1084833621 11:71787508-71787530 CCCGGCAAGGCTGAGGCCCCGCC 0: 1
1: 0
2: 8
3: 32
4: 300
Right 1084833634 11:71787538-71787560 TGGCGCCCGAGGAGAACGCGGGG 0: 6
1: 4
2: 0
3: 3
4: 48
1084833618_1084833634 15 Left 1084833618 11:71787500-71787522 CCCGGTCTCCCGGCAAGGCTGAG 0: 1
1: 0
2: 6
3: 22
4: 193
Right 1084833634 11:71787538-71787560 TGGCGCCCGAGGAGAACGCGGGG 0: 6
1: 4
2: 0
3: 3
4: 48
1084833624_1084833634 -9 Left 1084833624 11:71787524-71787546 CCCCGCCCCCGTCATGGCGCCCG 0: 1
1: 6
2: 4
3: 12
4: 167
Right 1084833634 11:71787538-71787560 TGGCGCCCGAGGAGAACGCGGGG 0: 6
1: 4
2: 0
3: 3
4: 48
1084833622_1084833634 6 Left 1084833622 11:71787509-71787531 CCGGCAAGGCTGAGGCCCCGCCC 0: 1
1: 0
2: 6
3: 56
4: 318
Right 1084833634 11:71787538-71787560 TGGCGCCCGAGGAGAACGCGGGG 0: 6
1: 4
2: 0
3: 3
4: 48
1084833625_1084833634 -10 Left 1084833625 11:71787525-71787547 CCCGCCCCCGTCATGGCGCCCGA 0: 1
1: 6
2: 1
3: 11
4: 71
Right 1084833634 11:71787538-71787560 TGGCGCCCGAGGAGAACGCGGGG 0: 6
1: 4
2: 0
3: 3
4: 48
1084833619_1084833634 14 Left 1084833619 11:71787501-71787523 CCGGTCTCCCGGCAAGGCTGAGG 0: 1
1: 1
2: 3
3: 13
4: 294
Right 1084833634 11:71787538-71787560 TGGCGCCCGAGGAGAACGCGGGG 0: 6
1: 4
2: 0
3: 3
4: 48
1084833617_1084833634 18 Left 1084833617 11:71787497-71787519 CCGCCCGGTCTCCCGGCAAGGCT 0: 1
1: 3
2: 5
3: 17
4: 149
Right 1084833634 11:71787538-71787560 TGGCGCCCGAGGAGAACGCGGGG 0: 6
1: 4
2: 0
3: 3
4: 48
1084833614_1084833634 25 Left 1084833614 11:71787490-71787512 CCGGCTTCCGCCCGGTCTCCCGG 0: 3
1: 2
2: 5
3: 12
4: 156
Right 1084833634 11:71787538-71787560 TGGCGCCCGAGGAGAACGCGGGG 0: 6
1: 4
2: 0
3: 3
4: 48
1084833613_1084833634 26 Left 1084833613 11:71787489-71787511 CCCGGCTTCCGCCCGGTCTCCCG 0: 3
1: 4
2: 4
3: 12
4: 198
Right 1084833634 11:71787538-71787560 TGGCGCCCGAGGAGAACGCGGGG 0: 6
1: 4
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084833634 Original CRISPR TGGCGCCCGAGGAGAACGCG GGG Exonic