ID: 1084835852 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:71801487-71801509 |
| Sequence | CTGCAGTTTAGGAAGTGATC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1084835852_1084835855 | -9 | Left | 1084835852 | 11:71801487-71801509 | CCTGATCACTTCCTAAACTGCAG | No data | ||
| Right | 1084835855 | 11:71801501-71801523 | AAACTGCAGCCTGGCCCACCCGG | No data | ||||
| 1084835852_1084835860 | 9 | Left | 1084835852 | 11:71801487-71801509 | CCTGATCACTTCCTAAACTGCAG | No data | ||
| Right | 1084835860 | 11:71801519-71801541 | CCCGGCTCCAGCATCATTTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1084835852 | Original CRISPR | CTGCAGTTTAGGAAGTGATC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||