ID: 1084835852

View in Genome Browser
Species Human (GRCh38)
Location 11:71801487-71801509
Sequence CTGCAGTTTAGGAAGTGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084835852_1084835855 -9 Left 1084835852 11:71801487-71801509 CCTGATCACTTCCTAAACTGCAG No data
Right 1084835855 11:71801501-71801523 AAACTGCAGCCTGGCCCACCCGG No data
1084835852_1084835860 9 Left 1084835852 11:71801487-71801509 CCTGATCACTTCCTAAACTGCAG No data
Right 1084835860 11:71801519-71801541 CCCGGCTCCAGCATCATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084835852 Original CRISPR CTGCAGTTTAGGAAGTGATC AGG (reversed) Intergenic
No off target data available for this crispr