ID: 1084836957

View in Genome Browser
Species Human (GRCh38)
Location 11:71809271-71809293
Sequence CAATACAGGCATACCCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084836951_1084836957 2 Left 1084836951 11:71809246-71809268 CCTGCCAGTCCAAAGTGAAACTC No data
Right 1084836957 11:71809271-71809293 CAATACAGGCATACCCTGGATGG No data
1084836953_1084836957 -7 Left 1084836953 11:71809255-71809277 CCAAAGTGAAACTCACCAATACA No data
Right 1084836957 11:71809271-71809293 CAATACAGGCATACCCTGGATGG No data
1084836952_1084836957 -2 Left 1084836952 11:71809250-71809272 CCAGTCCAAAGTGAAACTCACCA No data
Right 1084836957 11:71809271-71809293 CAATACAGGCATACCCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084836957 Original CRISPR CAATACAGGCATACCCTGGA TGG Intergenic
No off target data available for this crispr