ID: 1084837601

View in Genome Browser
Species Human (GRCh38)
Location 11:71813928-71813950
Sequence CGTCCTGTGCTGCCACCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084837601_1084837603 -9 Left 1084837601 11:71813928-71813950 CCATGAGGTGGCAGCACAGGACG No data
Right 1084837603 11:71813942-71813964 CACAGGACGTTTGGCCTTAGCGG No data
1084837601_1084837607 27 Left 1084837601 11:71813928-71813950 CCATGAGGTGGCAGCACAGGACG No data
Right 1084837607 11:71813978-71814000 GAATCACTGAAATTCAGGTGTGG No data
1084837601_1084837606 22 Left 1084837601 11:71813928-71813950 CCATGAGGTGGCAGCACAGGACG No data
Right 1084837606 11:71813973-71813995 AGTCTGAATCACTGAAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084837601 Original CRISPR CGTCCTGTGCTGCCACCTCA TGG (reversed) Intergenic
No off target data available for this crispr