ID: 1084839541

View in Genome Browser
Species Human (GRCh38)
Location 11:71833835-71833857
Sequence ACCAGGGATGACCCCACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084839537_1084839541 21 Left 1084839537 11:71833791-71833813 CCTTCTCAGCATCTAGTCTTGTA 0: 6
1: 0
2: 0
3: 19
4: 156
Right 1084839541 11:71833835-71833857 ACCAGGGATGACCCCACACCAGG 0: 1
1: 0
2: 0
3: 14
4: 187
1084839535_1084839541 28 Left 1084839535 11:71833784-71833806 CCCTCTTCCTTCTCAGCATCTAG 0: 6
1: 0
2: 7
3: 36
4: 515
Right 1084839541 11:71833835-71833857 ACCAGGGATGACCCCACACCAGG 0: 1
1: 0
2: 0
3: 14
4: 187
1084839536_1084839541 27 Left 1084839536 11:71833785-71833807 CCTCTTCCTTCTCAGCATCTAGT 0: 6
1: 0
2: 9
3: 76
4: 675
Right 1084839541 11:71833835-71833857 ACCAGGGATGACCCCACACCAGG 0: 1
1: 0
2: 0
3: 14
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084839541 Original CRISPR ACCAGGGATGACCCCACACC AGG Intronic
900472258 1:2860746-2860768 ACCACGGATGATCGCACTCCGGG - Intergenic
901487779 1:9577303-9577325 CCGAGGCATGACACCACACCCGG - Intronic
902219412 1:14955428-14955450 ACCAGGGCTGTCTCCACTCCTGG + Intronic
902768832 1:18634011-18634033 ACGAGGGATGAGGACACACCTGG - Intronic
905054478 1:35081071-35081093 AGCTGGGATTACACCACACCTGG + Intronic
906321669 1:44821088-44821110 ACCAGGAATGATCCCACCCCAGG - Intronic
907044960 1:51295002-51295024 ACCAGGCACGCCCCCACATCTGG + Intronic
907636313 1:56137944-56137966 ATCAGGGATGACCATACACGAGG - Intergenic
910737212 1:90473049-90473071 ACCAGGGATGCTCACACACAGGG - Intergenic
918131637 1:181634811-181634833 TCCAGGTATGTCCCCTCACCTGG + Intronic
922076867 1:222253768-222253790 GCCAGGGATGGCCAGACACCAGG + Intergenic
922452283 1:225746849-225746871 ATCAGGCAGGACCCCACCCCAGG + Intergenic
924243181 1:242059178-242059200 ACCACTGATGACCGCATACCTGG + Intergenic
1074323426 10:112424535-112424557 AACAGATATGTCCCCACACCAGG + Intronic
1078633928 11:13031189-13031211 ACCAGGGAAGCTCCCACACTAGG - Intergenic
1079119628 11:17672590-17672612 ACCAGGGCTGCCTCCAGACCAGG + Intergenic
1081613685 11:44578336-44578358 ACCAGGCAGGGCCTCACACCTGG - Intronic
1084775103 11:71369710-71369732 TCCTGGGAGTACCCCACACCAGG - Intergenic
1084839541 11:71833835-71833857 ACCAGGGATGACCCCACACCAGG + Intronic
1087464273 11:98485481-98485503 AGCTGGGATTACACCACACCAGG + Intergenic
1089589858 11:119533361-119533383 AACAGGGCTGAGCCCACAGCAGG + Intergenic
1089971672 11:122698609-122698631 ACCCAGGATGCTCCCACACCTGG - Intronic
1090979209 11:131702186-131702208 ACCAGGGATCGGCCCACACTTGG + Intronic
1091233575 11:134003627-134003649 CCCAGGGATGACCACAGTCCCGG + Intergenic
1093870396 12:24284299-24284321 TCCAGGGATCAGCCTACACCAGG - Intergenic
1094832784 12:34308107-34308129 ACCAGGGATGCCACTATACCAGG - Intergenic
1096783491 12:54004200-54004222 ACCAGGGAGCACCCCACTCCTGG - Intronic
1096919149 12:55065582-55065604 AGCAGGGATGGCCCCAGATCTGG + Intergenic
1097595966 12:61631140-61631162 AGCTGGGATTACACCACACCTGG - Intergenic
1101941798 12:109104720-109104742 GCCAGGGATGAACACACCCCTGG - Intronic
1102487091 12:113265894-113265916 AGCTGGGATGTCACCACACCTGG + Intronic
1102831544 12:116006371-116006393 ACCAAGGATGTCACTACACCAGG - Exonic
1107511298 13:41088119-41088141 AACAGGCATGCCACCACACCTGG + Intergenic
1113861103 13:113487955-113487977 ACAACTGATGACTCCACACCAGG + Intronic
1114194640 14:20466387-20466409 ACCACAGATGCCACCACACCTGG + Intergenic
1115235586 14:31206913-31206935 AGCGGGGTTGACCCCACACCCGG + Intronic
1115282433 14:31678595-31678617 ACCTGTGAGGACCCCACTCCAGG - Intronic
1115351368 14:32398992-32399014 ACCAGGCATGCCACCATACCTGG + Intronic
1115919177 14:38353980-38354002 ACCAGGCATGATCCCAATCCAGG + Intergenic
1120523267 14:85549021-85549043 ACCAGGGATGGCCAAACTCCAGG + Intronic
1120869803 14:89327004-89327026 ACCAGCAAAGACCCCACAGCTGG - Intronic
1121145591 14:91579424-91579446 GCCAGGGATGACCAGACTCCAGG + Intergenic
1121639310 14:95474786-95474808 AGCAGTGGTGACCCCACAGCTGG - Intronic
1121640188 14:95480166-95480188 CCCAGGGATGTCCCCAGACAGGG - Intergenic
1121769404 14:96519201-96519223 TACAGGGGTGAGCCCACACCTGG + Intronic
1121856091 14:97271443-97271465 ACCACGGATGGCCTCACACTTGG - Intergenic
1122086765 14:99312982-99313004 ACCAGGGAGCACACCACACCAGG - Intergenic
1122753215 14:103955064-103955086 CACAGGCATGAGCCCACACCCGG + Intronic
1122844410 14:104483786-104483808 ACCAGGCATGTCCCTCCACCTGG - Intronic
1123893210 15:24802281-24802303 GCCAGGGATGACCTGAAACCTGG - Intergenic
1124154044 15:27209626-27209648 ACCAGGGAGGCCCACCCACCTGG - Intronic
1124339326 15:28879820-28879842 GCCAGGGATGGCCGCAGACCAGG - Intergenic
1124941357 15:34221472-34221494 TACAGGCATGAGCCCACACCTGG - Intergenic
1126143532 15:45456306-45456328 ACTGGGGCTGACCCCACACAGGG - Intergenic
1129412348 15:75356884-75356906 TCCAGCGATGGGCCCACACCTGG + Exonic
1129718603 15:77865761-77865783 ACCAGGGCTGGGCACACACCAGG + Intergenic
1129788344 15:78323788-78323810 ACCAGGCAGAGCCCCACACCAGG + Intergenic
1132245449 15:100292933-100292955 ACCAAGGAAGACCCCACAGAGGG + Intronic
1132579488 16:678482-678504 ACCCGGCCTGACCACACACCTGG - Intronic
1134266347 16:12696216-12696238 AGCAGGCATGTCCCCAAACCAGG + Intronic
1136024747 16:27462275-27462297 ACCCAGGAAGGCCCCACACCTGG + Exonic
1137343884 16:47636847-47636869 ACCAGGGATGACCTGAAGCCTGG + Intronic
1138383357 16:56618676-56618698 AGCAGGGCTGTCCCCACATCAGG - Intergenic
1140708062 16:77649495-77649517 ACCAAGGACCACCCCACCCCAGG + Intergenic
1142362991 16:89636067-89636089 AGACGGGATGACCCCACACAGGG - Intronic
1143628807 17:8125548-8125570 GCCAGGGGCGGCCCCACACCCGG - Intergenic
1144961950 17:19049411-19049433 ACCAGAGAGGACCCCACAAATGG + Intergenic
1144973211 17:19125111-19125133 ACCAGAGAGGACCCCACAAATGG - Intergenic
1145268488 17:21391896-21391918 GCCAGACATGACCCCACACTTGG - Intronic
1147189065 17:38728559-38728581 ACCAGTTGTGACCCCACAGCAGG - Exonic
1148123185 17:45224099-45224121 ACCAGGGCTTACCCCCTACCAGG + Intronic
1148763814 17:50026081-50026103 ACCAGTGATCTCACCACACCTGG + Intergenic
1149582881 17:57763447-57763469 CCAGGGGATGACCCCACACTAGG + Intergenic
1151481864 17:74374348-74374370 ACCAGAAATCACCTCACACCGGG - Intergenic
1152083986 17:78206047-78206069 GCCAGGGATGAGGCCCCACCTGG - Exonic
1152271081 17:79325232-79325254 TCCAGGGATGAGCCCACCCAGGG - Intronic
1152464342 17:80457358-80457380 AGCAGGGCTGACTCCACAGCTGG + Intergenic
1152662475 17:81549124-81549146 ACCCAGGACGACCCCACACAGGG + Intronic
1158438265 18:57450010-57450032 TCCATGGCTGAACCCACACCAGG + Intronic
1158865686 18:61635946-61635968 CCCAGGGCTGCCCACACACCTGG - Intergenic
1160906939 19:1455988-1456010 CCCTGGGATGACCCCACCCTGGG - Intronic
1162152358 19:8655469-8655491 TCCAGGGGTGTCCCCGCACCTGG - Intergenic
1162189938 19:8936987-8937009 ACCAGTGATGTCAGCACACCTGG + Exonic
1162373127 19:10290611-10290633 ATCAGGAAGGACCCTACACCCGG - Intronic
1163639058 19:18451288-18451310 CCCAGGGTTGAGCCCACATCAGG + Intronic
1164920667 19:32086280-32086302 AGGGGGAATGACCCCACACCTGG - Intergenic
1166298915 19:41903412-41903434 GCCTGGGCTGGCCCCACACCCGG + Intronic
1167342342 19:48923104-48923126 CCCAGAGCTGACCCCACTCCAGG + Exonic
1167792920 19:51692022-51692044 CCCAGCGCTGACCCCATACCAGG - Intergenic
1168137359 19:54360450-54360472 TCCAGGGATGGCCCCTGACCAGG - Intronic
1168160718 19:54508635-54508657 TCCAGGGATGGCCCCTGACCAGG + Intronic
925281849 2:2690482-2690504 CACGGGGATGACCCCAGACCAGG + Intergenic
926427647 2:12753962-12753984 GGCAGTGAAGACCCCACACCAGG - Intergenic
927965829 2:27267489-27267511 ACCAGGTATGCTCCCACCCCAGG + Intronic
928598666 2:32882216-32882238 ACCAGCCATGACCCAACTCCAGG + Intergenic
929446219 2:42003464-42003486 ACCAGGTATGACCCGACTCAAGG + Intergenic
929694648 2:44103939-44103961 CACAGGGATGACCCCAGACAAGG - Intergenic
931504075 2:62904630-62904652 TCCAGGGGTACCCCCACACCTGG - Intronic
932323284 2:70837630-70837652 CCCAGAGAGGACCCCACACTGGG + Intergenic
933427056 2:82126613-82126635 GCCAGGGATGGCCACACTCCAGG - Intergenic
933720893 2:85396911-85396933 ACCTTGGTTGACCCCACAACTGG + Intronic
933846212 2:86329123-86329145 GCCAGGGATGGCCGCACTCCAGG - Intronic
937155155 2:119713892-119713914 ACCAGGGCAGACCCACCACCAGG + Intergenic
940015622 2:149101248-149101270 AGCAGGAATGAGCCCAAACCAGG + Intronic
945477568 2:210303608-210303630 GCCAGGGATGACCCCACTCAGGG - Intronic
947576507 2:231279203-231279225 ACCAGTGTTGCCCCAACACCTGG + Intronic
948406070 2:237720523-237720545 TACAGGCATGACACCACACCTGG + Intronic
948786928 2:240357502-240357524 AGAAGGGCTGACCCCACACGTGG + Intergenic
948922335 2:241071606-241071628 ACCAGGGAGGACACCACCCTCGG + Exonic
1168957494 20:1844625-1844647 ACCAGGGATGTGCCCACCTCAGG - Intergenic
1174062212 20:47840716-47840738 AGCAAGGATGACCCCTCACTGGG + Intergenic
1174069281 20:47888515-47888537 AGCAGGGATGACCCCTCACTGGG - Intergenic
1174150652 20:48483924-48483946 AGCAGGGATGACCCCTCACTGGG + Intergenic
1175846848 20:62064286-62064308 ACCCGGGCTGGCCCCGCACCTGG + Intronic
1176388776 21:6152766-6152788 ACAAGGGATGCACACACACCAGG + Intergenic
1176388786 21:6152824-6152846 ACCAGGGATGCACACACATCAGG + Intergenic
1179734686 21:43385424-43385446 ACCAGGGATGCACACACATCAGG - Intergenic
1179734696 21:43385482-43385504 ACAAGGGATGCACACACACCAGG - Intergenic
1179997236 21:44979661-44979683 GCCACGGATAACCCCACACTTGG - Intergenic
1182085035 22:27555621-27555643 TCCAGGGATGGCCCCACCACAGG + Intergenic
952953768 3:38544068-38544090 GCCAGGGAAGACCCCACCCAAGG + Intergenic
955017515 3:55086834-55086856 ACCAGTGATCCCCTCACACCTGG + Intergenic
956837909 3:73110720-73110742 TCCAGGGTTGACTCCACCCCCGG - Intergenic
960940066 3:122927750-122927772 ACCAGGGGAGTCCCCACCCCTGG + Intronic
962528283 3:136255251-136255273 CACAGAGATGACCCCACAGCAGG - Intronic
966533721 3:181008239-181008261 ACCTGGGATTACACCACACTTGG + Intergenic
968494221 4:906616-906638 CCCAGGGATGATGCCACACATGG - Intronic
968625325 4:1624298-1624320 ACCAGGGATGCCCCCAGGTCAGG + Intronic
968848710 4:3063009-3063031 CCCAGGGAGGACCCCTCCCCTGG - Intergenic
968966080 4:3769664-3769686 CCCAGGGCTGACCCCTCCCCAGG - Intergenic
969200560 4:5601218-5601240 ACCAAAGATGACCACATACCTGG + Intronic
969276362 4:6138377-6138399 AGCTGGGATTACACCACACCTGG + Intronic
969583421 4:8078477-8078499 GCCAGGGATGACCCCGCAGACGG - Intronic
969854981 4:9991731-9991753 ACCAGGGATGCACACACACAGGG + Intronic
970439532 4:16068113-16068135 ACCAGGGACCAGCCCTCACCTGG - Intronic
974645224 4:64681113-64681135 GCCATGGATGACACCACTCCAGG - Intergenic
975195515 4:71518811-71518833 ATCCGGGTTGCCCCCACACCAGG - Intronic
980079317 4:128327136-128327158 ATCAGTGATGGCCCCACACTGGG - Intergenic
983737270 4:171077543-171077565 ACCAGAGATGTCTCCACATCTGG + Intergenic
987192496 5:15492682-15492704 TCCAGTCATGACTCCACACCAGG - Intergenic
987637915 5:20569477-20569499 AGCTGGGATGACACCACGCCTGG - Intronic
992684309 5:79184777-79184799 AGCTGGGATTACACCACACCTGG - Intronic
1000117583 5:158167883-158167905 CCCAGGGATGAAGACACACCTGG + Intergenic
1002107803 5:176888777-176888799 ACCAAAGAGGACCCCACACCGGG + Exonic
1002493965 5:179599423-179599445 CCCAGGGATGACCCGACCCTGGG - Intronic
1002545428 5:179940101-179940123 ACCAGGCATGTCTGCACACCTGG + Intronic
1003090166 6:3094793-3094815 AACTGGGATTACCTCACACCTGG - Intronic
1004864168 6:19837406-19837428 GCCCGGGATCACCCCACTCCCGG - Exonic
1006440390 6:34050154-34050176 GCCAGGCATGAGCCCACCCCAGG + Intronic
1006827225 6:36944429-36944451 ACCCAGGCTGACCCCTCACCTGG - Intergenic
1007350641 6:41271171-41271193 ATCACGGATCACCCTACACCTGG + Intronic
1013826073 6:114213137-114213159 ACCAGGGATGGCCGAACTCCAGG - Intronic
1014331744 6:120076222-120076244 ATCAGGGATGAGCACACACAAGG + Intergenic
1014899649 6:126947355-126947377 ACCAGGGAAGACCCAAGCCCAGG - Intergenic
1015394281 6:132717552-132717574 AGCAGTGATCACCCCACCCCAGG + Intergenic
1017208270 6:151826968-151826990 ACCAGGGATGTTCCCACATCAGG - Intronic
1018908568 6:168089063-168089085 CCCAGGGCTGGCCCCACACCAGG + Intergenic
1019184641 6:170214000-170214022 AGCACGGAAGACTCCACACCAGG + Intergenic
1019510175 7:1413881-1413903 ACCAGGAAGGACCCCACGCGGGG - Intergenic
1019750527 7:2726327-2726349 AACATGGATGTCCCCAAACCTGG + Intronic
1023861883 7:44221531-44221553 ACCAGGGCTGTCCCCGCAGCAGG + Intronic
1024946223 7:54809742-54809764 TACAGGCATGACCCCACACCTGG + Intergenic
1025232227 7:57210448-57210470 AGCAAGGATGACCCCTCACTGGG - Intergenic
1026901395 7:74039415-74039437 CCCAGGGAGGCCCCCACATCCGG + Intronic
1029655732 7:101923178-101923200 TCCAGGGAGGACCCCACGCTGGG - Intronic
1032388443 7:131540385-131540407 CCCAGGGAAGGCCCCACCCCAGG + Intronic
1033545639 7:142397672-142397694 ACCAGAGAAGACCCCAGAGCAGG - Intergenic
1033928888 7:146499321-146499343 AACAGGCATGCCACCACACCTGG + Intronic
1035231782 7:157469847-157469869 TCCAGAGTTGACCCCACCCCGGG - Intergenic
1035978151 8:4336167-4336189 ACCAGCGCTGACCGCAAACCAGG - Intronic
1036098863 8:5755639-5755661 CCCAGAGCTGACCTCACACCTGG + Intergenic
1037764400 8:21763427-21763449 CTCAGGAATGACCTCACACCTGG + Intronic
1039515872 8:38132953-38132975 AGCTGGGATTACACCACACCCGG - Intronic
1049284306 8:141766331-141766353 TCCAGGGATGAAGCCAAACCAGG - Intergenic
1049712200 8:144070139-144070161 AGCAGGTTTGAACCCACACCGGG - Intergenic
1049767963 8:144363818-144363840 ACATGGGATGACCACATACCTGG - Intergenic
1051275364 9:15393218-15393240 GCCAGGTATCCCCCCACACCTGG - Intergenic
1052851597 9:33381578-33381600 ACCAGGGAAGGGCCCACAGCTGG - Intergenic
1053076607 9:35139246-35139268 ACCAGGGAGGACCCGAAAACGGG + Intergenic
1054458510 9:65449590-65449612 ACCAGGGGTGAGCCCAGTCCTGG + Intergenic
1056355622 9:85798632-85798654 TGCAGGGATTACACCACACCTGG + Intergenic
1056887644 9:90458716-90458738 ACCAAGGAAGACCTCACAGCTGG + Intergenic
1057130157 9:92649234-92649256 ACCAGGAATGAGCCTAAACCTGG + Intronic
1057477252 9:95413249-95413271 AGCAGGGCTGTCCCCACATCAGG + Intergenic
1059822126 9:117984853-117984875 ACCAGGGGTGATGCCACCCCAGG - Intergenic
1060823510 9:126674510-126674532 GTCAGGGATCTCCCCACACCAGG - Intronic
1060829958 9:126707223-126707245 ACCAGAGGAGACCCCACACCAGG - Intergenic
1061980651 9:134101626-134101648 GCCCGGGATGCCCCCACACCGGG - Intergenic
1062429996 9:136522755-136522777 CCCAGGGCTGCCCCTACACCAGG + Intronic
1062432423 9:136532068-136532090 GCCTGGGATTACCCCACACTTGG + Intronic
1185547397 X:956332-956354 ACCCAGGATGACCTGACACCAGG + Intergenic
1190984265 X:55487306-55487328 AGCAGGGATGACCACATACCAGG - Exonic
1192512282 X:71729371-71729393 ACCTGGGAATACACCACACCAGG + Intergenic
1192514415 X:71752138-71752160 ACCTGGGAATACACCACACCAGG - Intergenic
1193985699 X:88238048-88238070 ACCAGGGAAGACTCCAGACAGGG - Intergenic
1195211351 X:102654189-102654211 ACCTGGGCTGAGCCCACATCTGG - Exonic
1197743171 X:129911437-129911459 AGCTGGGATTACACCACACCCGG - Intronic
1198847510 X:140928353-140928375 ACCAGAGAAGACACCACTCCAGG + Intergenic
1201060088 Y:10037213-10037235 AGAAGGGAAGACCGCACACCTGG + Intergenic
1201504890 Y:14687322-14687344 AACAGGGATGTTCCCACCCCAGG - Intronic
1201758972 Y:17517916-17517938 ACCACTGATGACCATACACCTGG - Intergenic
1201842583 Y:18388074-18388096 ACCACTGATGACCATACACCTGG + Intergenic