ID: 1084847277

View in Genome Browser
Species Human (GRCh38)
Location 11:71910565-71910587
Sequence CACGGCATTCGGGTGTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 3, 1: 23, 2: 15, 3: 21, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084847267_1084847277 10 Left 1084847267 11:71910532-71910554 CCAGTAGGTTGAGGACCTTCTGC 0: 1
1: 21
2: 10
3: 34
4: 134
Right 1084847277 11:71910565-71910587 CACGGCATTCGGGTGTGCCAAGG 0: 3
1: 23
2: 15
3: 21
4: 49
1084847270_1084847277 -5 Left 1084847270 11:71910547-71910569 CCTTCTGCTGGGACACCCCACGG 0: 25
1: 18
2: 30
3: 28
4: 133
Right 1084847277 11:71910565-71910587 CACGGCATTCGGGTGTGCCAAGG 0: 3
1: 23
2: 15
3: 21
4: 49
1084847264_1084847277 28 Left 1084847264 11:71910514-71910536 CCTAGGCTGCGTGTTGCTCCAGT 0: 26
1: 29
2: 29
3: 28
4: 121
Right 1084847277 11:71910565-71910587 CACGGCATTCGGGTGTGCCAAGG 0: 3
1: 23
2: 15
3: 21
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084847277 Original CRISPR CACGGCATTCGGGTGTGCCA AGG Intronic
901460037 1:9385916-9385938 CACGTTATGTGGGTGTGCCAGGG + Intergenic
902986466 1:20157338-20157360 CATGGCAGTTGGGTGTGCCAAGG + Intergenic
907178812 1:52552738-52552760 AACGGGCTTCGGGTGTCCCAGGG - Intronic
1064397400 10:14992789-14992811 CACGGCAGTCGGGTGTGCCAAGG - Intergenic
1064400286 10:15015249-15015271 CACGGCAGTCGGGTGCACCAAGG - Intergenic
1066390248 10:34972430-34972452 CACAGCAGTTGGGTGCGCCAAGG + Intergenic
1070562954 10:77581648-77581670 CACGGCAGTTGGGTGGGCCCAGG - Intronic
1077589189 11:3478645-3478667 CACGGCAGTCAGGTGCGCCAAGG - Intergenic
1084227886 11:67728765-67728787 CACGGCAGTCGGGTGTACCAAGG - Intergenic
1084261289 11:67980448-67980470 CATGGCAGTCGGGTGCACCAAGG - Intergenic
1084807345 11:71588100-71588122 CACGGCAGTCAGGTGTGCCAAGG + Intronic
1084811361 11:71613648-71613670 CACGGCAGTCGGGTGTGCCAAGG + Intergenic
1084844425 11:71888109-71888131 CACGGCAGTTGGGTGTGCCAAGG + Intronic
1084847277 11:71910565-71910587 CACGGCATTCGGGTGTGCCAAGG + Intronic
1090027646 11:123181377-123181399 CATTGCATTGGGGTGAGCCAGGG - Intronic
1092021708 12:5208224-5208246 CACGACCTTCTGGTGTGCAAGGG - Intergenic
1092432565 12:8421016-8421038 CACGGCAGTCGGGTGTGCCAAGG - Intergenic
1093289138 12:17300498-17300520 CACAGCAGTCGAGTGAGCCAAGG + Intergenic
1096509170 12:52117973-52117995 CACGGCAGTCAGGTGCGCCAAGG - Intergenic
1104292750 12:127484467-127484489 CACGGCATTCGGGTGTGCCAAGG + Intergenic
1107544340 13:41422578-41422600 CAAGGCAGTCAGGTGTGCCAAGG - Intergenic
1117038630 14:51750671-51750693 CACAGCAGTCGGGTGCGCCAAGG + Intergenic
1119575369 14:75716185-75716207 CAGGGCACTGGGGTGTGACATGG + Intronic
1121035837 14:90702871-90702893 CACGGCTTTGGGGTGGGGCACGG + Intronic
1122835506 14:104428783-104428805 CACGGCCGTCGGGTGTGCCTAGG + Intergenic
1124004679 15:25786181-25786203 CACGGCATCAGGGTGGGCCAGGG + Intronic
1127096471 15:55516203-55516225 CATGGCAGTTGGGTGTGCGAAGG - Intergenic
1129030708 15:72615759-72615781 CATGGCATTAGGATGTGCCTAGG + Intergenic
1129477552 15:75796282-75796304 CATGGCATTAGGATGTGCCTAGG + Intergenic
1132307473 15:100826626-100826648 CAGGGCATGCCTGTGTGCCATGG - Intergenic
1133035490 16:3031643-3031665 CTGGGCATCTGGGTGTGCCAGGG - Intronic
1134504478 16:14793863-14793885 CACGGCAATCAGGAGTGGCAAGG - Intronic
1134576093 16:15335046-15335068 CACGGCAATCAGGAGTGGCAAGG + Intergenic
1136174867 16:28509647-28509669 CAAGGGATTGGGGTGTGTCAGGG - Intronic
1145865013 17:28235613-28235635 CACGGCAGTCGGGTGCGCCAAGG - Intergenic
1149075976 17:52596401-52596423 CATGGCAGTCGGGTGCACCAAGG + Intergenic
1150674745 17:67235131-67235153 CAGGGCATACCAGTGTGCCATGG - Intronic
1157198259 18:45637875-45637897 AAGGGCAGTCAGGTGTGCCATGG - Intronic
1163966527 19:20751906-20751928 CACGGCAGTCGGGTGCGCCAAGG - Intronic
1167942445 19:52958576-52958598 CATGGCAGTTGAGTGTGCCAAGG + Intronic
932349764 2:71022485-71022507 CACGGCAGTCGGGTGCACCAAGG + Intergenic
932353270 2:71048612-71048634 CATGGCAGTCGGGTGCGCCAAGG + Intergenic
940872024 2:158868260-158868282 CACAGCAGTCGGGTGTGCCAAGG + Intergenic
940874243 2:158884263-158884285 CACGGCAGTCGGGTGCGCCAAGG + Intergenic
947594828 2:231404412-231404434 CACGGCAGTCGGGTGCGCCAAGG + Intergenic
1171408388 20:24929129-24929151 CACGGCAGTCGGGTGGGCCAAGG + Intergenic
1174297869 20:49561753-49561775 GACTGCATTGGGCTGTGCCAAGG + Intronic
1174627988 20:51931202-51931224 CACGGCTTTACTGTGTGCCAGGG + Intergenic
1176388887 21:6153596-6153618 CCCGGCTCTCGGGGGTGCCAGGG + Intergenic
1179734585 21:43384652-43384674 CCCGGCTCTCGGGGGTGCCAGGG - Intergenic
1180042646 21:45288080-45288102 CACGGCCTCCGGGTCTGCAATGG - Intergenic
1180075209 21:45458516-45458538 CTGGGCATTTGGGTGTTCCAGGG - Intronic
1180917666 22:19500051-19500073 CAGGGCAGTGGGCTGTGCCAAGG - Intronic
1184113891 22:42410922-42410944 CCCGGCCTACGGCTGTGCCAGGG - Intronic
949157945 3:850012-850034 CACGGCAGTCGGGTGTGCCAAGG + Intergenic
949882879 3:8675441-8675463 CATTGCAGTCGGGTGTCCCAAGG + Intronic
957022352 3:75139846-75139868 CACGGCAGTCGGGTGTGCCAAGG + Intergenic
957044567 3:75363831-75363853 CACGGCATTCGGGTGTGCCAAGG - Intergenic
957076359 3:75606018-75606040 CACGGCAGTCAGGTGTGCCAAGG - Intergenic
961272082 3:125696930-125696952 CACGGCAGTCGGGTGTGCCACGG + Intergenic
961274943 3:125719163-125719185 CACGGCAGTCGGGTGTGCCAAGG + Intergenic
961277860 3:125741794-125741816 CACGGCAGTCGGGTGTGCCAAGG + Intergenic
961876561 3:130027868-130027890 CACGGCAGTCGGGTGTGCCAAGG - Intergenic
968988828 4:3895072-3895094 CACGGCAGTCGGGTGTGCCAAGG - Intergenic
969019807 4:4132313-4132335 CACGGCAGTCGGGTGCGCCAAGG - Intergenic
969024515 4:4162715-4162737 CACGGCAGTCGGGTGTGCCAAGG - Intergenic
969025421 4:4168663-4168685 CACGGCAGTCGGGTGTGCCAAGG - Intergenic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
969729305 4:8944448-8944470 CACGGCACTCGGGTGTGCCAAGG + Intergenic
969734050 4:8975100-8975122 CACGGCAGTCGGGTGCGCCAAGG + Intergenic
969749763 4:9101121-9101143 CACGGGAGTCGGGTGCGCCAAGG + Intergenic
969785479 4:9453982-9454004 CACGGCAGTCGGCTGTGCCAAGG + Intergenic
969788890 4:9478389-9478411 CACGGCAGTCGGGTGTGCCAAGG + Intergenic
969793629 4:9509157-9509179 CACGGAAGTCGGGTGCGCCAAGG + Intergenic
969826530 4:9762522-9762544 CACGGCAGTCGGGTGTGCCAAGG + Intergenic
981604832 4:146529555-146529577 CACGGCAGTCGGGTGCACAAAGG + Intergenic
985032928 4:185809821-185809843 CACAGCAGTCGGGTGTGCCCTGG + Intronic
985695471 5:1337747-1337769 CACTGCCTTCGAGTGTGCGAGGG - Intronic
1000752389 5:165113137-165113159 CATGGCATTCTGGGTTGCCAGGG - Intergenic
1012611856 6:101228250-101228272 CACAGCAGTCGGGTGCACCAAGG - Intergenic
1020307208 7:6844350-6844372 CACGGCAGTCGGATGCGCCAAGG - Intergenic
1020311685 7:6873186-6873208 CACGGCAGTCGGGTGTGCCAAGG - Intergenic
1020323228 7:6955520-6955542 CACGGCAGTTGGGTGCGCCAAGG - Intergenic
1027652984 7:80894004-80894026 CACAGCATTCATGTGTGTCAAGG - Intronic
1029078348 7:97953287-97953309 CACGGCAGTCCGGTGCGCCAAGG - Intergenic
1032348252 7:131136779-131136801 AAGGGCATTTGGGTGTTCCAGGG - Intronic
1036262218 8:7249932-7249954 CACGGCAGTCGGGTGTGCCAAGG - Intergenic
1036304370 8:7589626-7589648 CACGGCAGTCGGGTGTGCCAAGG + Intergenic
1036314257 8:7708471-7708493 CACGGCAGTCGGGTGTGCCAAGG - Intergenic
1036355222 8:8037618-8037640 CACGGCAGTCGGGTGTGCCAAGG + Intergenic
1036372842 8:8175463-8175485 CACGGCAGTCGGGTGCGCCAAGG + Intergenic
1036613551 8:10371027-10371049 CAGGGGATTCGGATGTGCCTAGG - Intronic
1036779352 8:11634892-11634914 CTCGGCATGAGGCTGTGCCATGG - Intergenic
1036833510 8:12039931-12039953 CACGGCAGTCGGGTGTGCCAAGG - Intergenic
1036855356 8:12286496-12286518 CACGGCAGTCGGGTGTGCCAAGG - Intergenic
1036878064 8:12490178-12490200 CACGGCAGTCGGGTGCGCCAAGG - Intergenic
1036903671 8:12690348-12690370 CACGGCAGTCGGGTGTGCCAAGG - Intergenic
1036906156 8:12709981-12710003 CACGGCAGTTGGGTGCGCCAAGG - Intergenic
1039278218 8:35955169-35955191 CACAGCAGTCGGGAGTGCCAAGG + Intergenic
1040277080 8:46019258-46019280 CACGGGGTTGGGGTGTGTCATGG - Intergenic
1047169512 8:122477512-122477534 CACGGCACTAGGGTGTGGCGGGG + Intergenic
1048957528 8:139549250-139549272 CACGGCAGCCAGGTGTGCCAAGG - Intergenic
1049407054 8:142456260-142456282 CACGTCTTTCAGGTGTGCGAGGG - Intronic
1051290095 9:15536511-15536533 CACTGCATTCCGGAGCGCCAGGG + Intergenic
1056865661 9:90225719-90225741 CATGGCAGTCGGGTGCACCAAGG + Intergenic
1056917347 9:90757183-90757205 CACGGCGGTCGGGTGCGCCAAGG - Intergenic
1062224335 9:135440920-135440942 CATGGCAGTTGGGTGCGCCAAGG - Intergenic
1186349399 X:8727732-8727754 CAAGGCTTTGGGGTGTGCCCAGG - Intronic
1190315042 X:49145318-49145340 CATGGCAGTCATGTGTGCCAAGG - Intergenic
1191214769 X:57922914-57922936 CACAGCAGTCGGGTTTGCCAAGG + Intergenic
1194400388 X:93433352-93433374 TACGGCAGTCAGGTGCGCCAAGG + Intergenic