ID: 1084855203

View in Genome Browser
Species Human (GRCh38)
Location 11:71980058-71980080
Sequence GTCTCCTAGAAAATGACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084855201_1084855203 -8 Left 1084855201 11:71980043-71980065 CCTGGTGCTCCTAGTGTCTCCTA 0: 1
1: 0
2: 2
3: 8
4: 120
Right 1084855203 11:71980058-71980080 GTCTCCTAGAAAATGACACCTGG 0: 1
1: 0
2: 0
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084855203 Original CRISPR GTCTCCTAGAAAATGACACC TGG Intronic
905321045 1:37117603-37117625 GTCTTCTAGATAAGGAAACCAGG + Intergenic
905823779 1:41014482-41014504 ATCACCCAGAAAATGTCACCTGG + Intergenic
909486206 1:76177276-76177298 CAGTCCTAGAAAATGAGACCTGG - Intronic
917325884 1:173831526-173831548 CTCTCCAAGAAAATGCCAACAGG + Exonic
1065381179 10:25091998-25092020 GTCTCCCAGGAAAGAACACCTGG - Intergenic
1065759328 10:28967257-28967279 GTCTCCTGAAAAATGACATAAGG - Intergenic
1065759864 10:28972508-28972530 GTCTCCTAGAAAGAAATACCCGG - Intergenic
1067151233 10:43736587-43736609 GTCTCCTGGAACATGCCACCAGG - Intergenic
1070748884 10:78952264-78952286 GTATCCTAGCAACTGACACAAGG + Intergenic
1071526823 10:86364078-86364100 TTCTCCTCGAAGATGGCACCTGG + Exonic
1071711119 10:88050514-88050536 TTCTTCTAGAAAATAACACATGG + Intergenic
1076199157 10:128544651-128544673 GTTTGCTACAAAATGTCACCTGG - Intergenic
1076569622 10:131424188-131424210 GTCTTCTAGAAAATCCCTCCAGG + Intergenic
1079378138 11:19912678-19912700 GTCTCTTGGAAATTTACACCAGG - Intronic
1080263835 11:30380125-30380147 GTCTCATAGTAACTGACACTTGG - Intergenic
1081778813 11:45695656-45695678 TTCTCCTGGAAAATGCCCCCTGG - Intergenic
1083104531 11:60345234-60345256 ATCTCCTATAAAATACCACCAGG - Intronic
1084855203 11:71980058-71980080 GTCTCCTAGAAAATGACACCTGG + Intronic
1086373983 11:86182067-86182089 GTCTCCTTGTCTATGACACCAGG - Intergenic
1089118787 11:116117512-116117534 GTCTCATTGGAAATCACACCTGG - Intergenic
1089182735 11:116594250-116594272 GTCTCCTTGCAGAGGACACCAGG + Intergenic
1094630992 12:32173385-32173407 GACTCCTAGAAACTTTCACCTGG + Intronic
1095381914 12:41605145-41605167 CTATCTTAGAAAATTACACCTGG + Intergenic
1097665474 12:62473097-62473119 GTCTCCTAAAAAAGCACAGCAGG + Intronic
1098286714 12:68914456-68914478 CTTGCCTAGAAAATGAGACCAGG + Intronic
1101697859 12:107143365-107143387 AACTCCTCAAAAATGACACCAGG - Intergenic
1103356518 12:120325568-120325590 CACTGCTAGAAAATGACACGTGG + Intronic
1112759263 13:102674782-102674804 GTCTTCTAGAAAATGCCTTCAGG + Intronic
1113073334 13:106443848-106443870 GTCTCCTGGAAAAGCACACGGGG - Intergenic
1113109380 13:106805883-106805905 GTCACCAAGAAAATGGGACCAGG + Intergenic
1113232293 13:108226215-108226237 GTCTAGTGGAAAATGACACAAGG + Intronic
1120861183 14:89256169-89256191 TTCCCCTTGAAAATGACAACAGG - Intronic
1121106311 14:91282123-91282145 GTCCCCTCCAAAATGACAACAGG + Intronic
1121824256 14:96997946-96997968 GTCTCTGAAAAAATGACAGCTGG + Intergenic
1123779351 15:23610018-23610040 GTCTCAGAGAACATAACACCTGG - Intronic
1124173616 15:27401618-27401640 GTCTCCTTGTAAGTAACACCAGG + Intronic
1126110182 15:45170464-45170486 GACTCCTAGAGTATGACAGCTGG + Intronic
1127013727 15:54659421-54659443 GTTTCCTACAAAATGACTTCTGG - Intergenic
1128585793 15:68849102-68849124 GTCTCATAGATAAGGAAACCGGG - Intronic
1128585962 15:68850272-68850294 GTCTCATAGATAAGGAAACCGGG - Intronic
1129286660 15:74530956-74530978 CTGTCCTAGAATAGGACACCTGG - Intergenic
1131183809 15:90258312-90258334 GCCTCCTTGAATAGGACACCTGG + Intronic
1131374531 15:91912776-91912798 GTCCCCTAGAAAGTCACCCCCGG - Intronic
1136058128 16:27706057-27706079 TTCTCATTGAAAATGACACAGGG + Intronic
1136631941 16:31493932-31493954 GTCTCCTGGAAAATGGCAGAGGG + Exonic
1136640772 16:31563452-31563474 GTCTCCTAGAGACTGAGATCTGG + Intergenic
1136664193 16:31793860-31793882 GTCTCCTAGAGACTGAGATCTGG - Intronic
1137704729 16:50526700-50526722 GGCTCCTACCAAATGACCCCAGG + Intergenic
1138112059 16:54331546-54331568 GTCTCCTACTGAGTGACACCAGG - Intergenic
1138572827 16:57886582-57886604 GTCTCCTGGACTCTGACACCAGG + Intronic
1138593433 16:58016105-58016127 CTCACCTGGACAATGACACCTGG - Intronic
1143754688 17:9057733-9057755 GTTTTCCAGAAAATGACACGTGG + Intronic
1148478769 17:47946411-47946433 GTCCTCTAGAAAGGGACACCAGG + Intronic
1151085893 17:71380284-71380306 GTCTCCTGGAAGCTAACACCGGG - Intergenic
1152320278 17:79605017-79605039 GTCTCCTTGTCTATGACACCAGG - Intergenic
1153093135 18:1371199-1371221 TTATCCTGGAAAATGACATCAGG - Intergenic
1159471530 18:68863324-68863346 GTCTCCTACAAAATGAAAGTCGG + Intronic
1159690996 18:71486886-71486908 GTGACCTAGAAAATGACACATGG - Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1161376162 19:3940042-3940064 GTAACCTAGAAAATGCCACTGGG + Intronic
1163417235 19:17194214-17194236 GCCTCCTAGAAAAAGACCCAAGG + Intronic
1164397875 19:27881635-27881657 ATCTCCTATAAAATGTCACCAGG + Intergenic
1164479763 19:28602395-28602417 CTGTCCCTGAAAATGACACCTGG - Intergenic
1166276074 19:41755220-41755242 GTCACAGAGAAAATAACACCAGG + Intronic
1166281324 19:41796269-41796291 GTCACAGAGAAAATAACACCAGG + Intergenic
1166630512 19:44402373-44402395 GTCTCCTAGGAAAGGTCACCTGG + Intergenic
1168439173 19:56348699-56348721 ATCTCCTATAAAATATCACCAGG + Intronic
927111502 2:19867105-19867127 GTCTCCTAGGCCATGAGACCAGG - Intergenic
934713453 2:96529975-96529997 GACTCCTAGAAGAGGACACAGGG - Intergenic
935436497 2:103040600-103040622 TTCTCATAGAAAATGAATCCTGG + Intergenic
939297368 2:140285499-140285521 GTCACCTTGAAAAGGTCACCTGG + Intronic
942758764 2:179373377-179373399 GTATCCTAGAAACTGTCTCCAGG + Intergenic
946673153 2:222128121-222128143 GTCTCCTAAAAGATGAAACCTGG + Intergenic
947268020 2:228303935-228303957 TTCTCCTATAAAATATCACCAGG - Intergenic
1171132776 20:22669489-22669511 GCCTCCGAGAAAATGAGACTGGG - Intergenic
1172650457 20:36498476-36498498 TTCACCCAGAAAATGACACCGGG + Intronic
1173969697 20:47142804-47142826 ATCTCCTGGAAAATGACCCTGGG - Intronic
1175732154 20:61361436-61361458 ATCCCCTGGAAAATCACACCTGG - Intronic
1176843734 21:13860586-13860608 GTGACCGAGAAAATGACATCTGG - Intergenic
1179134831 21:38670174-38670196 TTCACCTAGAAAGTGACCCCAGG - Intergenic
1179615479 21:42580515-42580537 GTCTCCTTTAAAATAGCACCAGG - Exonic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
1183583241 22:38737933-38737955 GCTTCCTGGAAAAGGACACCAGG - Intronic
1184039557 22:41934916-41934938 GTCTCCTGGACAATGTCACTGGG + Intergenic
949948919 3:9213074-9213096 GTCCCCTACAGAAGGACACCAGG - Intronic
951185549 3:19708636-19708658 TTCTCATAGAAAATGAGTCCGGG + Intergenic
951901511 3:27662254-27662276 TTCTCCAAGAAAATCAAACCAGG + Intergenic
954727252 3:52623294-52623316 GTTTCCTAAAAAATAACAGCTGG + Intronic
956571622 3:70703126-70703148 GACTCCTAGAAATTCACAACTGG - Intergenic
957911162 3:86621423-86621445 ATCTCCTATAAAATATCACCAGG + Intergenic
959228089 3:103612107-103612129 GTCTTCCAGAAAATACCACCTGG - Intergenic
959929841 3:111967864-111967886 GTCTTCTAGGAACTGCCACCAGG - Intronic
962690377 3:137890861-137890883 GTCTCCTATCAAGTGAGACCAGG + Intergenic
966057368 3:175711405-175711427 GTTTACTAGATAATGACAACAGG + Intronic
968815598 4:2820108-2820130 ATCTCCCAGAAAGTCACACCAGG + Intronic
971450235 4:26793248-26793270 TTCTCATGGAAAATGGCACCAGG + Intergenic
973037990 4:45431654-45431676 GTGTCCTAGAAAATGCCTTCAGG - Intergenic
976683964 4:87789836-87789858 GTCTCATAGAATTTGACATCAGG - Intergenic
979273996 4:118794223-118794245 GTCTTCTGGAAAATAAAACCTGG - Intronic
981209499 4:142086021-142086043 GACTAATAGAAGATGACACCTGG + Intronic
981214051 4:142142465-142142487 TTCTCCAATAAAATGAAACCAGG + Intronic
982434412 4:155367228-155367250 TTCTCTTAAAAAAAGACACCAGG - Intronic
983412737 4:167420128-167420150 GTCTCCTATAAAATATCACCTGG + Intergenic
985508305 5:297690-297712 GCCCACAAGAAAATGACACCAGG + Intronic
985739736 5:1607980-1608002 GCCCACAAGAAAATGACACCAGG - Intergenic
986865731 5:11984383-11984405 GTCAACTGGAAAATGACACATGG + Intergenic
989228453 5:39058087-39058109 GTCTCCGAGAAATTTAAACCGGG - Intronic
990485963 5:56259511-56259533 GTCTCCTTGAATCTGACACTGGG + Intergenic
999260601 5:150236326-150236348 TGCTCCAAGAAAATGTCACCTGG + Intronic
1003622652 6:7714844-7714866 CTCTCCTATCAAAAGACACCTGG + Intergenic
1004150972 6:13119838-13119860 GATTCCTGGAAAATGACACAGGG - Intronic
1006289053 6:33120343-33120365 ATCTCCTATAAAATATCACCAGG - Intergenic
1007375005 6:41450648-41450670 GTCTCCGATAAAATGACAGATGG - Intergenic
1009373239 6:62934815-62934837 GTCTCCCAGAAAAGAAAACCTGG - Intergenic
1010821098 6:80416963-80416985 GACTCCTACACAATGACAGCGGG - Intergenic
1011008786 6:82679838-82679860 GTCTCTGAGGAAGTGACACCAGG - Intergenic
1013301822 6:108811039-108811061 GTCCCCAAGAAAATGGCACGGGG + Intergenic
1013645505 6:112135354-112135376 GTCACCAAAAAAATTACACCTGG - Intronic
1014144849 6:117986168-117986190 GTCTCCCAGGAAATGAGAACTGG - Intronic
1021788200 7:24173569-24173591 GTTTCCTAGTAAATGGCTCCTGG + Intergenic
1024041434 7:45559126-45559148 GTCTGGTAGAAAATGACAACTGG - Intergenic
1026216873 7:68357423-68357445 GACTCCTTGCAAATCACACCAGG - Intergenic
1029853409 7:103488458-103488480 GTCTCAGTGACAATGACACCAGG + Intronic
1032706101 7:134422327-134422349 GTCTCATGGGAAATGCCACCAGG + Intergenic
1033921079 7:146392823-146392845 GACTCTTAGAAAATGACCTCAGG + Intronic
1035842573 8:2828332-2828354 GGTTCATGGAAAATGACACCAGG - Intergenic
1036039588 8:5060552-5060574 CTCTCCTGGAAAATGGGACCTGG + Intergenic
1036918773 8:12831813-12831835 GTGTCCCAGAAGATGACAACAGG - Intergenic
1042235512 8:66608806-66608828 GTCTTCTAGATAATTACACTAGG - Intronic
1042317428 8:67438731-67438753 GTCTCCTAGGATTTGATACCTGG - Intronic
1042395379 8:68285892-68285914 TTCTCCCATAAAAAGACACCAGG - Intergenic
1043912032 8:85874769-85874791 GACTACTAGAAATTGACACCTGG + Intergenic
1044549356 8:93495147-93495169 GTCTCCGAGTAGATGGCACCTGG - Intergenic
1045990932 8:108306877-108306899 GCCTCCTGGAAAATAACATCTGG - Intronic
1046273517 8:111926412-111926434 GACTCTTTGAAAATGACACGTGG + Intergenic
1049631972 8:143663758-143663780 GTATTCTAGAAAATGCCACCAGG + Intergenic
1050229591 9:3507041-3507063 TTCTACTAGAAAAAGACACTGGG + Intronic
1055799156 9:80013731-80013753 ATCACCAAGAAAATCACACCTGG - Intergenic
1056879794 9:90380188-90380210 GTCTCCTAGGAGATGAGTCCTGG - Intergenic
1059775617 9:117471923-117471945 GTTTACTAGATAATGACAACAGG - Intergenic
1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG + Intronic
1062539321 9:137034635-137034657 TTCTCCTTGAAACAGACACCCGG + Exonic
1192171861 X:68860697-68860719 ATCTCCTAGAAAATGACCACTGG - Intergenic
1197721635 X:129748872-129748894 GTCTTCAAGAAAAAGGCACCTGG + Intronic
1198860685 X:141066160-141066182 GTGTGCTTGAAAATGAGACCGGG - Intergenic
1198902005 X:141521226-141521248 GTGTGCTTGAAAATGAGACCGGG + Intergenic
1199851787 X:151729111-151729133 GTCTCCTAGAGGAAGACACTGGG - Intergenic