ID: 1084857944

View in Genome Browser
Species Human (GRCh38)
Location 11:72000818-72000840
Sequence TGGGTGGAGGGGCTGGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 581
Summary {0: 1, 1: 5, 2: 6, 3: 78, 4: 491}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084857944_1084857956 7 Left 1084857944 11:72000818-72000840 CCCAAGGCCAGCCCCTCCACCCA 0: 1
1: 5
2: 6
3: 78
4: 491
Right 1084857956 11:72000848-72000870 CTGGCCTCTGGCCATCTCAGAGG 0: 1
1: 0
2: 3
3: 30
4: 296
1084857944_1084857952 -5 Left 1084857944 11:72000818-72000840 CCCAAGGCCAGCCCCTCCACCCA 0: 1
1: 5
2: 6
3: 78
4: 491
Right 1084857952 11:72000836-72000858 ACCCAGAGCCTGCTGGCCTCTGG 0: 1
1: 2
2: 3
3: 33
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084857944 Original CRISPR TGGGTGGAGGGGCTGGCCTT GGG (reversed) Intronic
900094094 1:933405-933427 TGGGTGGAGGGGCTGTGGCTGGG - Intronic
900145539 1:1157439-1157461 GGGATGGAGGGGCTGGGCTGGGG - Intergenic
900158503 1:1212801-1212823 TGGGTGGTGGGTTTGGCCTCTGG + Intronic
900310874 1:2032596-2032618 TGGGTGGAAGGCCCGCCCTTGGG - Intergenic
900378779 1:2373495-2373517 TGGGAGGAGGGGCTGGGATCTGG + Intronic
900401972 1:2476348-2476370 AGGGTGGATAGGCTGGCCTGGGG + Exonic
900737931 1:4310760-4310782 TGGGAGAACGGGCTGGGCTTGGG + Intergenic
901209797 1:7518415-7518437 TGGGTGGAGACACTGACCTTGGG - Intronic
901231274 1:7642819-7642841 TGGCTGGAAGTGCTGGTCTTAGG - Intronic
901878830 1:12182063-12182085 TTGGGGTAGGGGCGGGCCTTGGG + Intronic
902190542 1:14759977-14759999 CGGGAGGAGGGGCTGCCCTGAGG - Intronic
902219459 1:14955636-14955658 TGACTGGAGGGGCAGGGCTTAGG + Intronic
902335816 1:15753937-15753959 TGAGTGGACGGTCTGGCCGTGGG + Intergenic
902406874 1:16189172-16189194 GGGGTGGAGAGGATGACCTTTGG - Intergenic
902487696 1:16759490-16759512 TGGGCGGGGGGGCGGGCGTTGGG - Intronic
902530919 1:17090211-17090233 TGAGTGCAGTAGCTGGCCTTTGG - Intronic
902639948 1:17760729-17760751 TGGGTGGACAAGGTGGCCTTGGG + Intronic
902808017 1:18872759-18872781 GGGGTGGAGGGGCTGGAGTGGGG + Exonic
903648948 1:24911506-24911528 TGGGTTGAGGTGCTGGCCTAAGG + Intronic
903649904 1:24916115-24916137 TGGGAGTAGGGGCTGGTCCTGGG - Intronic
903969084 1:27107474-27107496 TGTGTGGAGGGGCTGGGCTGTGG - Intronic
904120383 1:28194120-28194142 TGGGAGGAAGGGCTGGGCTTGGG + Intergenic
904540251 1:31227932-31227954 GGAGTGGAGGGGCTGGCCAGGGG - Intronic
904817540 1:33216831-33216853 TGGCTGGAGGGGCTGGGCAAGGG + Intergenic
904941547 1:34167173-34167195 TGAGTGGTGGTGGTGGCCTTGGG + Intronic
905229716 1:36507524-36507546 GTGGTGGAGGGGATGGACTTGGG + Intergenic
905885269 1:41488402-41488424 TGGGAAGAGGGGCTGGCCGGGGG + Intergenic
906343465 1:45001140-45001162 TGGGTGGAAGTGGTGGCCTTGGG + Intergenic
906675594 1:47691345-47691367 TGGGTGGAGGGGGTGGCTAGGGG - Intergenic
906712191 1:47939123-47939145 GGGGTGGGGGGGTTGGCATTAGG - Intronic
907040766 1:51257162-51257184 TGGCTGGAGGGGCTGGAGTTGGG + Intronic
907319879 1:53595538-53595560 TGGGTGGGGGTGCTGAGCTTTGG - Intronic
907459533 1:54597189-54597211 TGTGGGGAGGGGCTGCCCTTGGG + Intronic
907524024 1:55043500-55043522 ATGGGGGAGGGGGTGGCCTTTGG + Intronic
908229241 1:62087378-62087400 TGGGGGGCGGGGCGGGCCGTAGG + Intronic
908348228 1:63257968-63257990 TTGTTGGAGGGGCTTACCTTGGG + Intergenic
912449310 1:109759571-109759593 TGGGGAGAGTGGCTGCCCTTTGG + Intronic
912714892 1:111976198-111976220 TGGGTAGAGGGGCTTACCTATGG + Intronic
913087922 1:115456416-115456438 TGGGTGGAGAGGCTTCCCTGAGG - Intergenic
915288465 1:154867698-154867720 TGGCTGGGCGGGCTGGCCATCGG - Intronic
915671659 1:157494283-157494305 TGGGTTGAGAGGCTGGACTGTGG + Intergenic
915693012 1:157709364-157709386 TAGGTGGAGGTGCAGGCTTTAGG - Intergenic
915972929 1:160366894-160366916 TGGGGGCGGGGGCTGGCCCTGGG - Intergenic
916123514 1:161549821-161549843 TGGGTGGAGGGGCTGGGGAAAGG - Exonic
917791410 1:178501505-178501527 TGGATGGAGGGGCAGCTCTTAGG + Intergenic
918423747 1:184387625-184387647 TGGGCGGAGGGGCTGGGATGTGG + Intronic
919660098 1:200235922-200235944 TGGGAGGTGGGCCTGGTCTTAGG + Intergenic
920054975 1:203185028-203185050 TGGGTGGAGGGGATGACTGTAGG - Intronic
920252380 1:204630328-204630350 TGGTCGGAGGGGCTGGGCTCTGG + Intronic
922619843 1:226982811-226982833 TGGGTGGAGGGGACAGACTTGGG + Intronic
922858165 1:228792897-228792919 GGGGGTGAGGGGGTGGCCTTTGG + Intergenic
922983801 1:229850783-229850805 TGGGTGGAGGGGAAGCCCTTAGG + Intergenic
923390213 1:233507437-233507459 TGGGTGGATGAGCTGGGCTTGGG + Intergenic
924386039 1:243498495-243498517 TAGGTGGGGGGCCTGGCCTCAGG - Intronic
924596269 1:245447572-245447594 TGGGAGGCGGGGCTGGACTCTGG + Intronic
1062934864 10:1378153-1378175 TGGCTGCAGGAGCTGGCCTCTGG - Intronic
1063427862 10:5963800-5963822 TGGAGGGTGGCGCTGGCCTTTGG + Exonic
1064496088 10:15911945-15911967 GGGGAGGAGGGGCTTGCTTTAGG - Intergenic
1064948405 10:20818298-20818320 TGGGTGGGGGGGCTGGGGGTGGG + Intronic
1066058931 10:31705693-31705715 TGGGCTGTGGAGCTGGCCTTGGG + Intergenic
1066756460 10:38717174-38717196 TGGGAAGAGGGGCTGGAGTTGGG + Intergenic
1068928583 10:62565350-62565372 TGAGTGAAGGGGATTGCCTTTGG + Intronic
1069752046 10:70751239-70751261 TAGGTGCAGTGGCTGCCCTTGGG + Intronic
1069922719 10:71826774-71826796 TGGGTGGAGTGGCCGGCTCTAGG - Intronic
1070627826 10:78063667-78063689 AGGGCAGAGGGGCTGGCCTTGGG - Intergenic
1070687821 10:78502744-78502766 TGGCTGGAGAGGCTGCCCTTGGG + Intergenic
1071849784 10:89557113-89557135 TGGGAGGAGGGGATGGTCTTGGG + Intergenic
1072475988 10:95760303-95760325 AGGGTGAAGGGGCTTGCCATGGG - Intronic
1072803963 10:98412466-98412488 TGGGTGGATGTGCTGACCTCTGG + Intronic
1073494689 10:103880272-103880294 TGGGGGGAGGGGCAGGCTGTAGG + Intergenic
1073628323 10:105121930-105121952 TGGGAGGAGGGGCTGCCTTTGGG + Intronic
1074528663 10:114281694-114281716 GGGGTGGAGGGGCGGGGCTGGGG + Intronic
1075452576 10:122562374-122562396 TGGGTGGGAGGGCTGGGTTTGGG - Intronic
1075486099 10:122823079-122823101 GGGATGGTGGGGTTGGCCTTTGG + Intergenic
1076252291 10:128994310-128994332 TGCGTGGAGGAGCTGGCCCCTGG + Intergenic
1076384340 10:130045994-130046016 TGGGAGGTGGGGCTGGGCGTGGG + Intergenic
1076981070 11:205063-205085 AGGGGGGAGGGGCTGGGCCTTGG + Exonic
1077107209 11:847435-847457 CGTGGGGAGGGGCTGGACTTTGG + Intronic
1077181641 11:1219627-1219649 AGGGCTGAGGGGCTGGGCTTGGG + Intergenic
1077183283 11:1225775-1225797 AGGCTGGAGGGGCTGGAATTTGG + Intronic
1077310221 11:1885271-1885293 TGAATGGAGGGGCTGGCATGTGG - Intronic
1077327799 11:1971237-1971259 TGGGTGGAAGGGCTGGCTTCGGG - Intronic
1077524143 11:3054126-3054148 TGGGAGGAGGCGCTGGTCTCTGG - Intronic
1077854780 11:6112875-6112897 TTGGTGGAGGGGCAGGCTCTTGG - Intergenic
1077877014 11:6317590-6317612 TGGGTGGAGGACTTGACCTTGGG - Intergenic
1078463044 11:11530067-11530089 GGGATGGAGGGCCTGGCCCTGGG - Intronic
1078787399 11:14508366-14508388 TAGGTGGAAGGGTTGGCCTTAGG - Intronic
1080036549 11:27718535-27718557 TGGCGGGAGGGGCTGAGCTTGGG - Intronic
1080655011 11:34252021-34252043 TGGGTGGAGGGGATGGGAGTGGG - Intronic
1081710832 11:45214362-45214384 TGGGTGGAGGGGTTGGCTGGGGG - Intronic
1081887648 11:46512675-46512697 TGGGGGGAGGGGCGGCCCTTGGG - Intronic
1081909899 11:46694175-46694197 TTGCGGGAGGGTCTGGCCTTGGG - Intronic
1081968329 11:47182850-47182872 TGGGTGGTGGGGATGGCAGTGGG - Intronic
1082824239 11:57566714-57566736 AGGGTGGAGGGGCAGGCTCTAGG - Intronic
1083299800 11:61734431-61734453 TGGGTGTTGGGGCAGGCCTGGGG + Intronic
1083401995 11:62429939-62429961 TGGAAGGAGGAGCAGGCCTTGGG + Intergenic
1083735236 11:64676408-64676430 GGGGTGGAGGGCATGGCCTTGGG - Intronic
1083897364 11:65626773-65626795 TGGGGGGAGGGGCTGATCTGTGG - Intronic
1084285492 11:68128273-68128295 GGGGAGGAGGGGCAGGCCTTGGG + Intergenic
1084594301 11:70107882-70107904 GTGGTGGTGGGGCGGGCCTTGGG - Intronic
1084857944 11:72000818-72000840 TGGGTGGAGGGGCTGGCCTTGGG - Intronic
1085310301 11:75512498-75512520 CGGGTTGAGGGACAGGCCTTAGG - Intronic
1085386628 11:76161544-76161566 TGGATGGAGGGGCTGGGCCTGGG + Intergenic
1086061423 11:82703501-82703523 TGTGTGAAGAGGCTGGCCTATGG - Intergenic
1086199167 11:84179783-84179805 TGGCTAGAGGGTCTGGACTTGGG - Intronic
1086762124 11:90644648-90644670 TGGGTGAGGGGGATGGCTTTGGG - Intergenic
1088472214 11:110198667-110198689 GGGGTGGAGGGGATGGTTTTGGG - Intronic
1089134112 11:116235561-116235583 TGGGGAGAGAGGCTGGCATTGGG - Intergenic
1089587690 11:119520614-119520636 TGGGTGGAGGGGGTGGTGTGTGG + Intergenic
1090276267 11:125421992-125422014 TGGTTGGAGAAGCTGGCATTTGG + Intronic
1090608819 11:128451987-128452009 TGGGCAGAGCGGCTGGCTTTGGG - Intergenic
1090868093 11:130719749-130719771 TGCTTGGAGGGGCTGGGCTAAGG + Intergenic
1202810779 11_KI270721v1_random:26417-26439 TGGGTGGAAGGGCTGGCTTCGGG - Intergenic
1091574455 12:1720346-1720368 GGGGTGGAGGGGATGGTTTTGGG + Intronic
1091770697 12:3149262-3149284 TGTGTGTAGGGGCTGGACTTGGG + Intronic
1092017695 12:5172907-5172929 TGGGAGTGCGGGCTGGCCTTAGG - Intergenic
1092033113 12:5306356-5306378 TGGGCAGACGGGCTGGCTTTGGG + Intergenic
1092238042 12:6821968-6821990 GGGGAGGAGGGGCCGGCCTAGGG - Intronic
1092238881 12:6825675-6825697 TCAGAGGAGGGGCTGGGCTTTGG + Intronic
1094791000 12:33915131-33915153 GGGGTGGGGGGGCTAGCGTTAGG - Intergenic
1094797622 12:33994367-33994389 TGGGTGGAGGGGCCGGGGGTGGG - Intergenic
1095318190 12:40792226-40792248 TGGGTGGAGGAGCTGAGATTTGG - Intronic
1096403233 12:51324241-51324263 TGGGCTGAGGGGCGGGCCTCAGG - Intronic
1096558948 12:52422393-52422415 GGGGTGTGGGGGCTGGCCCTAGG - Intergenic
1096616159 12:52834580-52834602 TGGGTGGTGGGGGTGGCCATGGG - Intergenic
1096652725 12:53069823-53069845 TGGGTGGAGAGGGTGGGCTGGGG - Intronic
1096810825 12:54168725-54168747 TGGGGGGAGGGGCTTGAGTTGGG + Intronic
1098032276 12:66267034-66267056 TGGGTGGGGGCGGTGGCCTGTGG + Intergenic
1100235088 12:92652859-92652881 TTGGGGAAGGGGCTGGCCTGAGG - Intergenic
1101000971 12:100356956-100356978 TGGCTGGAGGGGCTGGAGCTAGG + Intergenic
1102258039 12:111427562-111427584 AGGCTGGAGTAGCTGGCCTTGGG + Intronic
1103346188 12:120251862-120251884 GGGGTGGAGGGTTTGGCTTTTGG - Intronic
1103447749 12:121005340-121005362 TGGGAGGAGGGGCTGGCATCTGG - Intronic
1103505221 12:121438500-121438522 TGGGTGATGGAGCTGCCCTTTGG - Intronic
1103578195 12:121894432-121894454 TGGAGGAAGAGGCTGGCCTTGGG + Intronic
1103795330 12:123499343-123499365 TGAGTGGAGGGTCTGGTCTCTGG + Intronic
1104658714 12:130593182-130593204 TGGGTGGAGGGTCCCTCCTTGGG - Intronic
1105303031 13:19152144-19152166 TGGGTGGTGGGGATGGCCCTGGG - Intergenic
1108272061 13:48771307-48771329 TGGGTGGAGGGTCTGGGTTGGGG - Intergenic
1108578713 13:51810974-51810996 TGTGTTGAGGGTGTGGCCTTGGG + Intergenic
1108678790 13:52761810-52761832 TGCGTGGAGGGGGTTGCCTGAGG - Intergenic
1109313988 13:60727979-60728001 TGGAGGGTGGGGCAGGCCTTAGG + Intergenic
1109805929 13:67442861-67442883 TGGGTGGAGGGGATGGGATGAGG - Intergenic
1112436460 13:99394344-99394366 GGGGCAGAGGGGCTGTCCTTAGG - Intergenic
1112611806 13:100962460-100962482 TGGATGGAGGGGCAGCGCTTAGG + Intergenic
1113454512 13:110438563-110438585 TGGCTGGAGGGGCCGCCCCTGGG + Intronic
1113662201 13:112115176-112115198 TGAGTGGAAGGGCTGGCCATGGG + Intergenic
1114551316 14:23534278-23534300 TGGGTGGAGAGGGTGGGCTGAGG + Exonic
1114574516 14:23700062-23700084 TGGGGGGTGGGGCAGGCCATGGG + Intergenic
1114628559 14:24145390-24145412 TGGGTGGAGGGTCTGGGATGGGG + Exonic
1114659974 14:24337875-24337897 TGGAAGGAGGGTCTGTCCTTGGG + Exonic
1117435638 14:55712996-55713018 TGAGGTGAGGAGCTGGCCTTTGG + Intergenic
1117818281 14:59620793-59620815 TGGGTGGTGGGGCTGGTCCAGGG + Intronic
1117994219 14:61463310-61463332 TGGGTGTCTGGGCTGGCCATTGG - Intronic
1118261904 14:64255568-64255590 TAGGTGGTGGAGCTGGACTTGGG - Intronic
1118303471 14:64635399-64635421 TGGTTGGAGGGGCAGGCATCAGG - Intergenic
1118460626 14:65983997-65984019 TGGGTGGGCAGGCTGGCATTGGG - Intronic
1119233167 14:72997124-72997146 TGAGTGGAAGGGTCGGCCTTAGG - Intronic
1119536750 14:75409116-75409138 TGGCTGCAGGGCCTGGCCTGTGG + Intergenic
1120635688 14:86948164-86948186 TGGGGGGAGGGGGTGGTTTTGGG + Intergenic
1120710757 14:87790653-87790675 TGGGTGGAGGGTGTGTCCTAAGG + Intergenic
1121047646 14:90799684-90799706 TGGGTGGAGGGAAGGGCGTTGGG + Intronic
1121051367 14:90820898-90820920 AAGGTGGAGGGGCTGGGATTGGG + Intergenic
1121702406 14:95964600-95964622 TGGAAGGAGGGGCTGAACTTGGG - Intergenic
1121798649 14:96755555-96755577 GGGGTGGAGGGGCTGACTTCAGG - Intergenic
1122058988 14:99124202-99124224 TGGGAGGAGGGGCTGGAAGTTGG - Intergenic
1122100551 14:99406033-99406055 TGGGAGGAGGGGTAAGCCTTTGG - Intronic
1122143800 14:99677026-99677048 GGGGTGGCTGGGCAGGCCTTGGG + Exonic
1122236523 14:100333496-100333518 TCAGAGGAGGGGCTGGCCGTGGG - Intergenic
1122414227 14:101541115-101541137 TGGGAGCAGGGCCTGGCCTCGGG - Intergenic
1122785767 14:104162684-104162706 AGGGTGGAGGAGCTGGCTCTGGG + Intronic
1122816467 14:104316486-104316508 TTGGCGGAGGGGCAGGGCTTGGG + Intergenic
1123440727 15:20289239-20289261 TGGGAGGAGGGGCTGGAGTTGGG + Intergenic
1123813148 15:23949485-23949507 TAGGTGGAGGAACTGCCCTTGGG + Intergenic
1124182801 15:27492764-27492786 TGCGTGTAAAGGCTGGCCTTAGG + Intronic
1124605555 15:31167815-31167837 TGGGTAGAGGCGCTGAACTTGGG + Intergenic
1124687230 15:31792822-31792844 TGGGTTGAGGGGCTGTCCTCAGG + Intronic
1124843091 15:33263135-33263157 TGAGTGGAGAGGTGGGCCTTAGG - Intergenic
1126262650 15:46712330-46712352 GGGGTGGTGGGGCTGACATTAGG + Intergenic
1127142430 15:55991749-55991771 AGGGTGGAGTTTCTGGCCTTTGG + Intronic
1127772778 15:62244279-62244301 TCTGGGGAGGGGCTGGCCTAGGG - Intergenic
1127996016 15:64153471-64153493 TGGGTGGAGGGGCTTTTTTTTGG + Intronic
1128261234 15:66234581-66234603 TGGGTGGTGGGCCTGGGCCTGGG - Intronic
1128706897 15:69843165-69843187 TGGGGGGAGGGGCTGGGCGTGGG - Intergenic
1129462409 15:75706177-75706199 TGGGGGAAGGGGCTGCTCTTAGG + Intronic
1129468733 15:75738566-75738588 TGCGTCGTGGGGCTGGACTTGGG + Intergenic
1129539997 15:76341373-76341395 AGAGGGGAGGGGGTGGCCTTGGG + Intronic
1129663198 15:77564863-77564885 TGCTGGGAGGGGGTGGCCTTGGG - Intergenic
1129671671 15:77611061-77611083 TGGGAGGAGGGGCAGGCTTGTGG + Intergenic
1131116225 15:89797742-89797764 TGGGTGGAGGTGCTTTACTTGGG - Intronic
1131438875 15:92443654-92443676 TGTGTGGAGGAGATGGGCTTGGG - Intronic
1132354274 15:101159586-101159608 TGGGTGGAGGGTGTTGTCTTGGG + Intergenic
1132377362 15:101338400-101338422 AGTGTGGAGGGGCCGGCCTGGGG - Intronic
1132579345 16:677951-677973 TGGGTGGTGCTGCTGGCCTACGG + Exonic
1132591221 16:727222-727244 TGGGAGGAAGGCGTGGCCTTTGG + Intronic
1134053858 16:11156907-11156929 TGGGGGGGGGGGCGGGCATTTGG - Intronic
1134197355 16:12169445-12169467 TGGCTGGAGGGCCTGGGCTGGGG + Intronic
1135173710 16:20209636-20209658 TGGCAGGAGGGGCTGTCCTTTGG - Intergenic
1136370057 16:29830676-29830698 TGGGTGTGGGGGCTGGGCTGTGG + Intronic
1136726127 16:32359151-32359173 TGGGAGGAGGGGCTGGAGTTGGG - Intergenic
1136844459 16:33565196-33565218 TGGGAGGAGGGGCTGGAGTTGGG - Intergenic
1137661041 16:50206637-50206659 TGAGCAGAGGGGCTGGCCGTGGG + Intronic
1138433865 16:56986305-56986327 TGGATGGAGGGGCTGGAATTTGG - Intergenic
1139917844 16:70439149-70439171 TGGGGGGAGGGGCCGGGCTGAGG - Intronic
1140769592 16:78191170-78191192 TGGCTGGCGGGCTTGGCCTTGGG - Intronic
1141317374 16:82975200-82975222 TGGTTGGATGGTCTGGTCTTTGG + Intronic
1141380374 16:83570990-83571012 TAGCTGGAGGTGCTGGCCCTTGG - Intronic
1141635203 16:85310798-85310820 TGAGGGGAGGGGCTGGGCTGGGG - Intergenic
1141662906 16:85451262-85451284 TGGGTGCAGGGGCTGGAGGTGGG - Intergenic
1141789396 16:86224167-86224189 GGAGTGGAGGGTCTGGGCTTTGG - Intergenic
1141876953 16:86831746-86831768 TGGGTGGTGGGGATGGTTTTAGG - Intergenic
1142029500 16:87831531-87831553 TGGCTGGAGGAGCTGGCCTGTGG - Exonic
1142147565 16:88498974-88498996 TGCGTGGAGAGGCAGGCCTGGGG - Intronic
1142249692 16:88985685-88985707 TGGGTGGAGGGACTTCCCTGAGG + Intergenic
1142345998 16:89554289-89554311 TGGGTGGGTGGGCTGGCATGCGG + Intronic
1142378120 16:89717190-89717212 TGGGTGGGGGGACTTGCCTGGGG - Intronic
1203000304 16_KI270728v1_random:158605-158627 TGGGAGGAGGGGCTGGAGTTGGG + Intergenic
1203131906 16_KI270728v1_random:1695008-1695030 TGGGAGGAGGGGCTGGAGTTGGG + Intergenic
1203154626 16_KI270728v1_random:1865495-1865517 TGGGAGGAGGGGCTGGAGTTGGG - Intergenic
1142593766 17:1019752-1019774 GGGGTGGAGGGGCTGGCCCCTGG + Intronic
1142713490 17:1735965-1735987 TGGGTGGTGGGCAGGGCCTTGGG + Intronic
1143204455 17:5132448-5132470 TGCGTGGAGGGGCTGGTCCAGGG + Intronic
1143550460 17:7627477-7627499 CAGGGGGAGGGGCTCGCCTTGGG - Intronic
1144777394 17:17791689-17791711 TGCATGGAGGGGCTGGCCATTGG - Intronic
1144959380 17:19036294-19036316 TGGTAGGAGAGGCTGGCCTCAGG - Intronic
1144975779 17:19138230-19138252 TGGTAGGAGAGGCTGGCCTCAGG + Intronic
1145241775 17:21244289-21244311 CGGGTGGAGGGACAGGCATTTGG + Intronic
1145389564 17:22445083-22445105 TGGGTGGTGGCTCTAGCCTTTGG - Intergenic
1145396021 17:22495643-22495665 TGGGTGGAATGGCTGAGCTTAGG - Intergenic
1145785619 17:27591936-27591958 TAGCCGGAGGGGCTGCCCTTTGG + Intronic
1146516770 17:33495667-33495689 AGGGTGGGGGGCCTGGCCTTTGG - Intronic
1146569288 17:33939002-33939024 TGGGTGGGAGGGCTGGCCCCGGG - Intronic
1146844206 17:36173373-36173395 TGCGTGGAGGGGCTGGTCCAGGG - Intronic
1146845403 17:36178982-36179004 TGGGTGGAGGGCCTGGCCTTTGG + Intronic
1146856511 17:36261308-36261330 TGCGTGGAGGGGCTGGTCCAGGG - Intronic
1146864106 17:36327067-36327089 TGCGTGGAGGGGCTGGTCCAGGG + Intronic
1146872421 17:36385219-36385241 TGCGTGGAGGGGCTGGTCCAGGG - Intronic
1146873618 17:36390825-36390847 TGGGTGGAGGGCCTGGCCTTTGG + Intronic
1146879779 17:36436304-36436326 TGCGTGGAGGGGCTGGTCCAGGG - Intronic
1146880977 17:36441913-36441935 TGGGTGGAGGGCCTGGCCTTTGG + Intergenic
1147054922 17:37826637-37826659 TGGGTGGCGGGGCAGGCGTGGGG - Intergenic
1147065770 17:37922048-37922070 TGGGTGGAGGGCCTGGCCTTTGG - Intergenic
1147066966 17:37927655-37927677 TGCGTGGAGGGGCTGGTCCAGGG + Intronic
1147075305 17:37985843-37985865 TGCGTGGAGGGGCTGGTCCAGGG - Intronic
1147078498 17:38007216-38007238 TGCGTGGAGGGGCTGGTCCAGGG + Intronic
1147086830 17:38065389-38065411 TGCGTGGAGGGGCTGGTCCAGGG - Intronic
1147094436 17:38131151-38131173 TGCGTGGAGGGGCTGGTCCAGGG + Intergenic
1147102775 17:38189352-38189374 TGCGTGGAGGGGCTGGTCCAGGG - Intergenic
1147308560 17:39579926-39579948 TGGGTGGAGGGGCTGGCAGTGGG + Intergenic
1147325177 17:39666573-39666595 TGGTTGGGGGGGCTGGCCCATGG + Intergenic
1147359756 17:39923308-39923330 TGGGTGGAGGAGCTGGGCAGGGG - Intronic
1147661791 17:42120928-42120950 GGGGTGAAGGGGCGGGGCTTGGG - Intronic
1147662667 17:42125325-42125347 TGGGCGGTGGGGCAGACCTTGGG - Intronic
1147965947 17:44194238-44194260 TGGGTGCAAGGGATAGCCTTTGG - Exonic
1148186549 17:45648802-45648824 AGGGTGGGGGGGCTGGTCCTAGG - Intergenic
1148688128 17:49512178-49512200 TGGATGGAGAGGCTGGCCGAGGG + Intronic
1148864257 17:50620433-50620455 TGTGGGAAGGGGCTGGGCTTGGG - Intronic
1148945843 17:51260852-51260874 TGCTTGGAGGAGCTGGTCTTCGG + Exonic
1149037293 17:52149235-52149257 TGGCTGAAGGGGCTGGCAGTAGG - Intronic
1149755700 17:59183661-59183683 GAACTGGAGGGGCTGGCCTTAGG - Intronic
1150270619 17:63862180-63862202 TGGGTGGAGGGGACAGCATTTGG + Intergenic
1150274246 17:63885702-63885724 TGGGTGGAGGGGACAGCATTTGG + Intergenic
1151185905 17:72363678-72363700 TGGGTGGGGTGGCAGGCCTCTGG + Intergenic
1151668370 17:75558307-75558329 GGTGTGGAGAGGCTGGCATTCGG + Intronic
1152394279 17:80023181-80023203 AGGGTGGAGGGGGTGGCCTGGGG - Intronic
1152433862 17:80263485-80263507 AGCGGGGAGGGGCTGGGCTTGGG + Intronic
1152696536 17:81800492-81800514 AGGGTGGTGGGGCTGCCCCTCGG - Intergenic
1152698558 17:81807949-81807971 TTGGAGGAGGAGCTGGCCTAGGG - Intronic
1153137120 18:1929716-1929738 TGGATGGAGGGGCTTCCCTGTGG - Intergenic
1153410708 18:4789504-4789526 TGGGTGGGGGGGGTGGCTGTGGG - Intergenic
1153859798 18:9190679-9190701 CTGGTGGAGGGTCTTGCCTTAGG - Intronic
1154197000 18:12274061-12274083 TGGGGGGAGGGGCAGGCTTCAGG - Intronic
1154198801 18:12285181-12285203 AGGGAGGCAGGGCTGGCCTTGGG + Intergenic
1154485344 18:14867778-14867800 TAGGAGGAGAGGCTGGACTTTGG + Intergenic
1156027319 18:32669835-32669857 TGGGTGGCTGGGCAGGCCTCAGG + Intergenic
1156357086 18:36351162-36351184 TAGGAAGAGGGGCTGCCCTTTGG - Intronic
1157243003 18:46028473-46028495 TGCCTGGAGGAGCTGGTCTTCGG + Intronic
1158278812 18:55798615-55798637 TGGGTGGGGGGGATAGCATTAGG - Intergenic
1160229637 18:77037463-77037485 TGGCTGGAGGGGCTGTTTTTAGG + Intronic
1160388457 18:78512378-78512400 TGCGTGCAGGTGCTGGCCGTAGG - Intergenic
1160807465 19:998709-998731 GGGCTGGAGGGGGTGGCCTGCGG + Intergenic
1160864617 19:1251221-1251243 TGGGGGCAGGGGCTGCCCTGGGG + Intronic
1160919091 19:1511637-1511659 AGAGTGGAGTGGCTGGCCTCAGG - Intronic
1161579064 19:5070855-5070877 TGTGTGGAGGGGATGGCCGGGGG - Intronic
1161631247 19:5357174-5357196 TGTGGGGAGGGGTTGTCCTTGGG + Intergenic
1161643284 19:5436995-5437017 AGGGTCCAGGGGCTGGACTTGGG + Intergenic
1161914009 19:7215414-7215436 TGGGTGGAGGGGGTGGTGGTGGG - Intronic
1162957430 19:14107122-14107144 TGGGGGCAGGGGCGGGCCGTTGG + Intronic
1163156907 19:15444630-15444652 TGGGTGCAAGGGCTGGTTTTAGG + Intronic
1163585208 19:18160287-18160309 TGGGTGGAGGGGCTGGGAAAGGG - Intronic
1164483351 19:28633057-28633079 TGGGTTAAGGGGCTGGACTGGGG - Intergenic
1164630312 19:29757744-29757766 TGTGGGGAGGGGCTGGCCTGAGG - Intergenic
1164922980 19:32103439-32103461 TGAGAGCTGGGGCTGGCCTTGGG - Intergenic
1165263665 19:34642276-34642298 AGGGTGGAGGGGCTCTCCTGTGG - Intronic
1166383630 19:42368683-42368705 GGGGGAGAGGGGCTGGCCCTTGG + Intronic
1166810123 19:45509373-45509395 GGGGTGGAGGGGCGGGGCTGGGG - Intronic
1166828015 19:45621399-45621421 GGGGAGGAGGGTCTGGCGTTGGG + Intronic
1166930252 19:46297802-46297824 TGAGATGAGGGGCTGGACTTTGG - Intronic
1167360970 19:49030162-49030184 TAGGTGGAGGGGCTGCCGCTGGG + Intronic
1167539339 19:50075283-50075305 AGGGAGGAGGGGCTGGGCCTGGG + Intergenic
1168077934 19:53991040-53991062 AGGGAGGAGGGGCTGGGCCTGGG - Intergenic
1168110600 19:54189598-54189620 TACGTGAAGGGGCGGGCCTTCGG + Exonic
1168583353 19:57573602-57573624 TGGGTGGATGGACTGGCCTCTGG + Exonic
1202703504 1_KI270713v1_random:4750-4772 TGGGCGGGGGGGCGGGCGTTGGG + Intergenic
925917468 2:8617028-8617050 TGTGTGTAGGGGCTTCCCTTTGG - Intergenic
926152962 2:10434823-10434845 GGGGTGCAGGGGCTGGGCTGGGG + Intergenic
926173218 2:10566874-10566896 TGGGTGATGGGGCTGGCCCAGGG - Intergenic
926348752 2:11975610-11975632 TGGGTAGAGGGGCTCTCCTGTGG + Intergenic
926562746 2:14435324-14435346 TGGGGGGTGGGGCAGGCCATAGG + Intergenic
926751082 2:16199026-16199048 TGGCTGGTGGGTCGGGCCTTTGG + Intergenic
927220774 2:20707073-20707095 TGGTTGGTGGGTATGGCCTTTGG - Intronic
927247026 2:20965432-20965454 TGGGCAGAGGGGATGGCGTTGGG - Intergenic
928875312 2:36031847-36031869 CAGGTAGAGGGGCTGCCCTTGGG - Intergenic
929906949 2:46054781-46054803 TGGGGGGTGGGGCGGGCCATGGG - Intronic
929978472 2:46657025-46657047 TGTGTGTAGGGGCTGGGGTTTGG - Intergenic
931179663 2:59886706-59886728 TCAGTGAAGGGGCTGGCCCTGGG - Intergenic
931697147 2:64879810-64879832 TTCCTGGAGGGACTGGCCTTAGG + Intergenic
932574448 2:72955047-72955069 GGGGTGGAGGGGCTGTCCCGTGG - Intronic
933235858 2:79863768-79863790 TTGTTGGAGGGTGTGGCCTTGGG + Intronic
933966408 2:87432993-87433015 TGGCTGGAGGGGCTGGCCATAGG - Intergenic
934319759 2:91961430-91961452 TGGAAGGAGGGGCTGGAGTTGGG + Intergenic
935330677 2:101975125-101975147 TGGGTAGAGGGGCTGGGACTGGG + Intergenic
935692286 2:105742790-105742812 TGGGAGGAGGAGCTGGTCTGGGG + Intergenic
936327387 2:111517492-111517514 TGGCTGGAGGGGCTGGCCATAGG + Intergenic
937094835 2:119228633-119228655 TGGGTGGAGGGGCAGGCATCTGG + Intronic
937210592 2:120266970-120266992 TGGGAGGATGGGCTGGCCGGGGG + Intronic
937597960 2:123692589-123692611 TGGCTGGAGGAGCTGAACTTGGG - Intergenic
937884028 2:126888033-126888055 TGGATGGAGGGTCAGGCCCTGGG - Intergenic
937913145 2:127085846-127085868 TGGCAGGAGGGGCTGGCTCTAGG + Intronic
937916499 2:127101768-127101790 GGGGTGGAGGGTTTGGGCTTGGG - Intronic
938101152 2:128498987-128499009 TGGGTGGAGGCACTGGGTTTTGG + Intergenic
938289098 2:130140147-130140169 TGGGTGGTGGGGGTGGCCCTGGG - Intronic
938467430 2:131532791-131532813 TGGGTGGTGGGGGTGGCCCTGGG + Intronic
939563500 2:143759179-143759201 TAGGTGGAGGGGTGGGGCTTGGG + Intronic
939925026 2:148162038-148162060 TAGGTGGAGGAGCTGGCCTTTGG - Intronic
940012452 2:149069173-149069195 GGGCTGGTGGGGGTGGCCTTGGG + Intronic
941862407 2:170297295-170297317 TTGGGGGAGGGGGTGGCCATTGG - Intronic
941987560 2:171523310-171523332 TGGGTAAAGGGGCTGGCCAAGGG + Intronic
942261778 2:174172357-174172379 TGCGTGTTGGGCCTGGCCTTCGG - Intronic
942640902 2:178059474-178059496 TGCCTGCAGGGGCTGGCCTAGGG + Intronic
944887840 2:204083043-204083065 TGGTTAGTGGGGATGGCCTTGGG + Intergenic
946215988 2:218183963-218183985 TGGGGGGTGGGGCAGGCCATGGG + Intergenic
947020181 2:225665958-225665980 TGGGTGGAGTGGCTAGACCTGGG + Intergenic
947530351 2:230905125-230905147 TGGGTGGAGGGGTTTCCCTGAGG - Intergenic
947591374 2:231388109-231388131 TGGGTGGTGGGGCTGGGACTTGG - Intergenic
948111310 2:235458299-235458321 TGGGAGGTGAGGCTGGCCCTTGG + Intergenic
948208840 2:236178037-236178059 GGGGTTGAGGGGGTGGCCCTGGG - Intergenic
948402167 2:237692148-237692170 TGGGGGGCGGGGCGGGCCGTGGG + Intronic
948478995 2:238239012-238239034 TGGACGGAGTGGCTGGCCTGCGG - Exonic
948854777 2:240724997-240725019 TGGGAGGAGGGGCAGGCCCAGGG - Intronic
1169115758 20:3064637-3064659 TGGGTGGCGGGGCAGTCATTGGG + Intergenic
1171249873 20:23638760-23638782 TGGGAGGAGGGACAGGTCTTTGG - Intergenic
1171443652 20:25187398-25187420 TGGGAGGAGGGGCAGGCCCCAGG + Intergenic
1171494921 20:25548799-25548821 TGGGTGCTGGGGCCAGCCTTGGG - Intronic
1172181185 20:33004493-33004515 TGGGTGGAGGGGCAGGGGATGGG + Intergenic
1172573334 20:35987178-35987200 TGGCTGGAGGGGAGGGCCTTGGG + Intronic
1173363230 20:42363220-42363242 GGGGTGGAGGGGTGTGCCTTTGG - Intronic
1173534678 20:43800423-43800445 TGGGGAGAGGGGAAGGCCTTGGG + Intergenic
1173983054 20:47239753-47239775 TGGGGGAAGGTTCTGGCCTTGGG - Intronic
1174467989 20:50731870-50731892 TGGGCGGAGCGGCGGGCCTGGGG + Intronic
1174489654 20:50883952-50883974 TGGTTGAAGAGGCTGGCCTCGGG - Intergenic
1175217124 20:57397180-57397202 TGTGTGGAGGGCCTGGCCCTGGG + Intronic
1175377100 20:58535593-58535615 TGGCTGGAGGGGCGGGGCTGTGG + Intergenic
1175814591 20:61876981-61877003 TGGGTGCAGGCTCTGACCTTGGG + Intronic
1175977517 20:62718544-62718566 TGGGTGGAGGGGCGGGCATCGGG - Intronic
1176221015 20:63969494-63969516 TGGGTGGCGAGGCTGGCCCCAGG - Intronic
1176236690 20:64056766-64056788 ATGGGGGAGGGGCAGGCCTTTGG + Intronic
1176240128 20:64072074-64072096 TGGGTGGAGAGCCCAGCCTTGGG + Intronic
1176723980 21:10414686-10414708 TAGGAGGAGAGGCTGGACTTTGG + Intergenic
1176795990 21:13371698-13371720 TAGGCGGAGAGGCTGGACTTTGG - Intergenic
1177486590 21:21765348-21765370 TGGGGGGAGGGGATAGCATTAGG + Intergenic
1178552958 21:33557235-33557257 TAGGTGGAGGTGCAGGCTTTAGG - Exonic
1180160898 21:45998249-45998271 TGGGTGGGCGGGCTGGCCCCAGG + Intronic
1180253463 21:46605704-46605726 GGGGTGGAGGGAAAGGCCTTGGG - Intergenic
1180305225 22:11067860-11067882 TAGGAGGAGAGGCTGGACTTTGG + Intergenic
1180308010 22:11145474-11145496 TGGGAGGAGGGGCTGGAGTTGGG + Intergenic
1180546486 22:16507287-16507309 TGGGAGGAGGGGCTGGAGTTGGG + Intergenic
1181005597 22:20012073-20012095 TGGGTGGGGGGGGGGGACTTTGG - Intronic
1181108385 22:20587797-20587819 TGGGTGGTGGGGATGGCCCTGGG - Intergenic
1181512915 22:23396760-23396782 TGGGAGGAGGGGGTGGCCGATGG - Intergenic
1181670151 22:24422164-24422186 AGGGTGGAGGGGCTTGCCCAGGG - Intronic
1181695465 22:24590771-24590793 TGGGTGGTGAGGCTGGCTTCAGG - Intronic
1181768917 22:25111745-25111767 GGGGTGGAGGGGGCGGCCTTTGG - Intronic
1181862024 22:25826432-25826454 TGTGTGGAGGGGATGGCCTCGGG + Exonic
1182212703 22:28690092-28690114 TGGGAGGAGGGGCTGGAGTTGGG - Intronic
1182350856 22:29698662-29698684 TGGGTGGTGGGGCTGTCTTGTGG + Intergenic
1183302175 22:37063802-37063824 TGGGTGGAGGGTCTGGGGTCTGG - Intergenic
1183346331 22:37310320-37310342 TGGGTGGAGGAGCTGGGGTTTGG - Intronic
1183459990 22:37944080-37944102 TGGTAGGATGGGCTGGCCTGAGG + Exonic
1184059509 22:42073761-42073783 TGGGTGGAGGAGGAGGCCTGCGG - Intergenic
1184306571 22:43606995-43607017 TGGCTGGGGGTGCTGGCCCTGGG - Intronic
1184556787 22:45237561-45237583 CAGGTGGAGGCGCTGGGCTTTGG - Intronic
1184775527 22:46621004-46621026 CAGGTGGAGGGGCTGGTCCTGGG + Intronic
1184783550 22:46660870-46660892 TGGCTGGAGGGGCTGGGTGTGGG + Intronic
1185280489 22:49967792-49967814 TGGGAAGCTGGGCTGGCCTTGGG + Intergenic
949699691 3:6742370-6742392 TGGGCAGAGGGGCTTCCCTTAGG - Intergenic
950052400 3:10002614-10002636 TGGGTGGAGGGGGAGGCCACAGG - Intronic
950052452 3:10002887-10002909 TGGGTGGAGGGGAAGGCCATGGG - Intronic
950170650 3:10837072-10837094 TGGCAGGAGGGGCTGGCCCTGGG + Intronic
950304513 3:11907786-11907808 TGGGTGGAAGGGGAGGCCATGGG - Intergenic
950304534 3:11907872-11907894 TGGGTGGAGGGGGAGGCCACAGG - Intergenic
950532822 3:13562796-13562818 TGGGTGCAGGGGCTGGAGGTGGG - Intronic
951266853 3:20577731-20577753 TATCTGGAGGGGCTGGCCATGGG - Intergenic
951756469 3:26096569-26096591 TGGCTGGAGTGGCTGGCCACAGG + Intergenic
952886974 3:38017996-38018018 TGGGTGAGGGCGCTGGCCTTGGG - Intronic
953772122 3:45785790-45785812 TGTGAGGCTGGGCTGGCCTTGGG + Intronic
954201242 3:49024614-49024636 TGGGTAGAGGGGCTGGTCCAGGG - Intronic
954452090 3:50577181-50577203 TGGGTGGAGGGGCTCACCTGGGG - Exonic
954611573 3:51947205-51947227 TGGGTGGAGGAGCTGGTCTGGGG - Intronic
954951386 3:54477470-54477492 TGGGTGCTGGGGCTGTTCTTGGG - Intronic
956253659 3:67261271-67261293 TGGGAGGAGGAGCTGGCCCAGGG - Intergenic
959825810 3:110794427-110794449 TGGGGGGCGGGGCTGGTCCTGGG + Intergenic
960509110 3:118526753-118526775 TGGGCTGCAGGGCTGGCCTTAGG - Intergenic
960586015 3:119322534-119322556 TGGGTGGAGGCGCTGGCCGCGGG - Intronic
960961965 3:123077515-123077537 TGGGAGAAGAGGCTGGCCCTGGG - Intronic
962748046 3:138412081-138412103 TTGGTGGAGGGTCTGGCATGGGG - Intergenic
963902140 3:150743069-150743091 TGGGTGGTGGGGATGGGGTTGGG + Intronic
964043944 3:152298710-152298732 TCAGTGGAGGGGCAGGACTTGGG + Intronic
964608195 3:158581446-158581468 TGGCTGGAGGAGCTGGAGTTGGG - Intronic
964616380 3:158671101-158671123 TGGTTGGAGGGGCTGGCTGAAGG + Intronic
965670950 3:171147243-171147265 TGGGTGGAGGGGATGGTTTGAGG - Intronic
966919922 3:184604535-184604557 TGGGTGGGGGGTCTGGCCTGGGG + Intronic
966929866 3:184669436-184669458 TGGCAGGAGGGACTGGACTTGGG + Intronic
968084245 3:195867476-195867498 TTGGTGGAGAAGTTGGCCTTGGG + Exonic
968126751 3:196165773-196165795 GGGGTGGAGGGGATGCCCTCAGG - Intergenic
968231562 3:197007655-197007677 TGGGTGGGGGAGCTGGGCTGTGG + Intronic
968664137 4:1811384-1811406 TGGCTGCAGGGGCTGGGCCTTGG - Intergenic
968818606 4:2834196-2834218 TGGGGGCCGGGGCTGGCCCTGGG + Exonic
969374319 4:6753184-6753206 TGGAGGGCGGGGCTGCCCTTTGG + Intergenic
969528979 4:7719455-7719477 TGAGTGGCAGGGCTGGCGTTGGG + Intronic
969621140 4:8279515-8279537 GGGGTCCAGGGGCTGGGCTTTGG + Intronic
969680539 4:8640886-8640908 TGGGTGGTGGCCCTGCCCTTTGG + Intergenic
969685562 4:8672171-8672193 TGGGAGGAGGGGCTGTCCAGTGG + Intergenic
979487198 4:121283291-121283313 AGGCTGCAGGGGCTTGCCTTGGG - Intergenic
982364804 4:154565867-154565889 TGGGCGGTGGGGCAGGCCTCAGG - Exonic
983186418 4:164706086-164706108 TGGGTGGTGGGGCTGGCCATGGG - Intergenic
984849944 4:184144429-184144451 TGAGTGGCGGGGCTGCCGTTTGG - Intronic
985164119 4:187074364-187074386 TGGGAGGAGGCACTGGCCCTGGG + Intergenic
985539044 5:479307-479329 TGGGTGGGGCGCCTGGCCTCTGG + Intronic
985665279 5:1178903-1178925 TGGCAGGTGGGGGTGGCCTTGGG - Intergenic
985668390 5:1193542-1193564 TGGGTGGAGGGGCAGGGCCAGGG + Intergenic
986705202 5:10448790-10448812 TGGAAGGCGGGGCTGGCCTTTGG + Intronic
986813450 5:11383973-11383995 GGGAGGGAGGGGCTGGGCTTGGG - Intronic
987294381 5:16537136-16537158 TTGGTGCAGGGCCTGGCCCTTGG - Intronic
987488163 5:18546327-18546349 TGTGTGGAGTGGCCAGCCTTGGG - Intergenic
988348390 5:30069783-30069805 TGGGTGGTGGGGGTTGCCATAGG - Intergenic
989212183 5:38866813-38866835 AGGGTGGAGGGGCTGTCTTGTGG + Intronic
990003889 5:50923309-50923331 TGGGTGGAGGCCTTGGCCCTGGG - Intergenic
990315571 5:54579793-54579815 AGGAGGGTGGGGCTGGCCTTAGG + Intergenic
992728321 5:79631832-79631854 TAGGTGGAGTGATTGGCCTTAGG + Intronic
993440853 5:87955155-87955177 TGGGTGGGGGGGCTGGCGGGAGG + Intergenic
993473640 5:88336615-88336637 TGGGAGGAGGGGGTTGCCTATGG + Intergenic
993736021 5:91477459-91477481 TGGGCGGTGGGGCAGGCCTTGGG + Intergenic
994306646 5:98213599-98213621 TGGGTGGAGGGTCTGGGATGGGG - Intergenic
994652309 5:102543876-102543898 TGGGTGGAGGGGATGGCAGTGGG + Intergenic
997291352 5:132737761-132737783 TGGGAGGAGGAGCTGCTCTTAGG + Intergenic
998142524 5:139708345-139708367 TGGGAGGAGGGGCTGGGGGTTGG - Intergenic
998204440 5:140148825-140148847 TGGGAGGAGGAGCTGGGATTGGG + Intergenic
999382048 5:151128138-151128160 TGGCTGGAGGGCATGGCCTTGGG - Intronic
1000082190 5:157858856-157858878 GGGGAGAAGGAGCTGGCCTTGGG - Intronic
1001543795 5:172557675-172557697 AGGGAAGAGGGGCTTGCCTTTGG - Intergenic
1001629485 5:173164106-173164128 TGGGAGGAAGGTCTGGCATTGGG + Exonic
1002163890 5:177332857-177332879 TGGGTGGAGGAGCTGGGGTCTGG + Intronic
1002280022 5:178124481-178124503 TGGAGGGAGGGGCTGCCCTGAGG - Exonic
1002694274 5:181073768-181073790 TGGCTATAGGGGCTGGCGTTGGG - Intergenic
1002710041 5:181189984-181190006 TGGGTGCCGTGGCTGGCTTTCGG + Intergenic
1002724122 5:181283217-181283239 TAGGAGGAGAGGCTGGACTTTGG + Intergenic
1002861546 6:1084084-1084106 TGTGTGCAGGGACTGGACTTGGG + Intergenic
1004422746 6:15486428-15486450 GGGGTGGATGGGGTGGGCTTGGG + Intronic
1004496508 6:16168477-16168499 TGGGTGGAGGGTGATGCCTTAGG + Intergenic
1005885353 6:30093320-30093342 TGGGGGGCGGGGCTGCCCATAGG + Intergenic
1006058163 6:31400840-31400862 GGGGTGGAGGGGGAGGGCTTTGG + Intronic
1006117701 6:31784132-31784154 GGGGTGGAGGGGTTGGACTTAGG - Intronic
1011129435 6:84038143-84038165 TGGGAGGAAGGGCTGGCCTAAGG + Intronic
1011492744 6:87909293-87909315 TGGGTGGAGGGATTGGACTTAGG + Intergenic
1011975374 6:93289548-93289570 TGGGAGGTGGGGCTTGCATTGGG + Intronic
1014145109 6:117988515-117988537 TCGGTTGAGGGGCTGGCTCTGGG - Intronic
1014180049 6:118374541-118374563 TGGGCAGAGGGGCTTGCATTTGG + Intergenic
1016074407 6:139778705-139778727 TGGGGGGTGGGGGTGGCATTGGG + Intergenic
1016486438 6:144544817-144544839 TAAGTGGAGGAGCTGGTCTTAGG - Intronic
1016737261 6:147492797-147492819 TGAGAGGAGGACCTGGCCTTGGG - Intergenic
1016917649 6:149259801-149259823 TGAGTGGAAGGGGTGGCTTTGGG - Intronic
1017854414 6:158337640-158337662 TGGGTGCAGGGACTTGGCTTTGG - Intronic
1018776728 6:167023951-167023973 TGGCTGGAGGGGCAGGATTTAGG + Intronic
1018942547 6:168319266-168319288 TGGATGGAGGGGACGTCCTTTGG - Intronic
1019704358 7:2490388-2490410 TGGGTGGAGGGGCTGGGCCCAGG - Intergenic
1019754985 7:2762451-2762473 TGGGTTCAGAGGCTGGACTTTGG - Intronic
1020264481 7:6551264-6551286 GAGGTGGAGGGGCTGGCGGTGGG - Exonic
1021092667 7:16501835-16501857 TGGGGGGTGGGGCGGGCCATGGG - Intronic
1021571019 7:22065281-22065303 TGGGTGGAGGGGAAGGCAGTGGG + Intergenic
1021944770 7:25715898-25715920 TGGGTAGAGGTGATGGCCTCAGG + Intergenic
1022671326 7:32458949-32458971 TGGGGGGAGGGGCGGGTGTTAGG - Intergenic
1023037643 7:36147393-36147415 TGGGTGGAGGGGAAGGCCTCAGG - Intergenic
1023837941 7:44079519-44079541 TGGGTGGGTGGGGAGGCCTTGGG - Intronic
1027269009 7:76510313-76510335 GGGGAGGAGGGTCTGGCTTTTGG - Intergenic
1027476508 7:78638404-78638426 TGGGTAGAGGAGATGGACTTTGG - Intronic
1031428837 7:121640382-121640404 GGGGTGGAGGGTATGCCCTTTGG - Intergenic
1032283868 7:130526824-130526846 TGGGTGGTGGGGATGGGGTTCGG + Intronic
1032284597 7:130531056-130531078 TGGGTGGTGGGGATGGGGTTCGG + Intronic
1032285423 7:130535639-130535661 TGGGTGGAGGGGATGGGGTTTGG + Intronic
1032286206 7:130540038-130540060 TGGGTGAAGGGGATGGGGTTTGG + Intronic
1032709101 7:134447104-134447126 CGTGTGCAGGGGCAGGCCTTGGG - Intronic
1032850783 7:135793349-135793371 TGTGGGGAGAGGCTGGCCATGGG - Intergenic
1034276633 7:149826706-149826728 TGGGTGCAGGGGCAGGCAGTGGG - Intergenic
1035026477 7:155830007-155830029 TGGAAGGAGGGGACGGCCTTTGG - Intergenic
1035053013 7:156014879-156014901 TGGGTGGGGGTGTTGGCCTCGGG + Intergenic
1036114147 8:5940455-5940477 TGGGTGGAGATTGTGGCCTTAGG + Intergenic
1036436902 8:8743071-8743093 TGGGTGAAGGGCCTGGCCCCTGG - Intergenic
1036514285 8:9429426-9429448 TGGGTGAAGGGGGTGGCTCTTGG + Intergenic
1036669282 8:10770124-10770146 TGGGTGGAAGGTTTGGACTTGGG - Intronic
1037402012 8:18503186-18503208 GGGGTGGAGGGGCTGGGTTCTGG - Intergenic
1037784824 8:21896337-21896359 TGGATGGAGAGGCTGCACTTAGG - Intergenic
1037971641 8:23176309-23176331 TGGGGAGAGGGGCTGGTATTTGG + Intergenic
1039507467 8:38062262-38062284 TGTGTGGCAGGCCTGGCCTTTGG + Intergenic
1039608570 8:38901664-38901686 TTGGAGGAGGGGCTGCCCTCGGG - Intronic
1039843796 8:41311442-41311464 GAGGTGGAGGGCCTGGCCCTAGG - Intergenic
1042416786 8:68528956-68528978 TGAGTGGAGGAGCTTGCCCTAGG - Intronic
1043401240 8:79886553-79886575 TGTGTGGTGGGGCTGGACTTGGG - Intergenic
1044422595 8:92015070-92015092 TGGGAGGCAGGGCTGGCCCTGGG - Intronic
1044591543 8:93917581-93917603 TGGATGGAGGGGCTGGCCCTCGG + Intronic
1045127740 8:99112286-99112308 TAGATGGAAGGGCTGGACTTAGG + Intronic
1045367002 8:101485571-101485593 TGGGTGGAGGTGGTGGCCTAGGG + Intergenic
1046664642 8:116987302-116987324 TGGGGGGAGGGGATAGCATTAGG + Intronic
1046949163 8:120003437-120003459 TGGGAGGAGGGCATGACCTTGGG + Intronic
1048439565 8:134450100-134450122 TGGGGGGTGGGGCAGGCCATGGG - Intergenic
1048974729 8:139664802-139664824 TGGCTGGAGGAGCTGGCTCTTGG - Intronic
1049107837 8:140624694-140624716 TGGGAGGAAGGGTTGGACTTCGG + Intronic
1049541904 8:143212452-143212474 TGAGAGGAGGGGGTGGCCTCAGG + Intergenic
1049580658 8:143409097-143409119 TGGGAGGAGGGGCAGGGCCTGGG + Intergenic
1049604171 8:143521396-143521418 TGGGGGCAGGGGCTGCCCATGGG - Intronic
1049746742 8:144266289-144266311 GGGGGGGCGGGGCTGGTCTTTGG - Intronic
1049973372 9:840558-840580 TGAGGTGAAGGGCTGGCCTTAGG + Intergenic
1049993659 9:1013972-1013994 TTGATGGAGGGGCTGGCAGTAGG - Intergenic
1050093481 9:2039688-2039710 TTCGGGGAGGGGCTGGCCTCGGG - Exonic
1050434711 9:5597050-5597072 AGGGAGGAGGGCCTGGTCTTTGG + Intergenic
1050631148 9:7560145-7560167 TGGGTAGAGGAGCAGGACTTGGG + Intergenic
1050926874 9:11274905-11274927 TGGGTGCATGGGCTTGGCTTTGG - Intergenic
1052367429 9:27628495-27628517 TGGGTGGAGGGGATGGAGTGGGG + Intergenic
1052998831 9:34566135-34566157 TGGGAGGAGGGGGTGGCCAGTGG - Intronic
1053072108 9:35107731-35107753 GGCCTGGAGGGGCTGGCCCTGGG + Exonic
1053136616 9:35654733-35654755 TGGGAGGAGGGGATGGTTTTGGG + Intergenic
1053886261 9:42646651-42646673 TAGGAGGAGAGGCTGGACTTTGG + Intergenic
1054225281 9:62454100-62454122 TAGGAGGAGAGGCTGGACTTTGG + Intergenic
1054863782 9:69979224-69979246 TGGGTGAAGGGGAAGACCTTGGG - Intergenic
1055600179 9:77908328-77908350 TGGGAGCAGTGGCTGGCCTCTGG - Intronic
1056222100 9:84460040-84460062 CAGGTGGTGGGACTGGCCTTTGG + Intergenic
1056807573 9:89740845-89740867 AGGGTGCAGGGGCTGTCCCTAGG - Intergenic
1057247492 9:93469088-93469110 TGAAAGGAGGGGCTGGCCCTGGG - Intronic
1057921809 9:99104466-99104488 TGGGTGGGGGAGCTGGGTTTGGG + Intronic
1058628416 9:106959906-106959928 TGGGTGGAGGAGCTATCCTAAGG + Intronic
1059053257 9:110952281-110952303 TGGGTTGAGGGGCTCTCCTGTGG - Intronic
1060050748 9:120376525-120376547 TGGTAGGAGGGGCTGGCCTAGGG - Intergenic
1060596534 9:124852323-124852345 GGGGTGGAGCAGCTGGGCTTTGG - Intergenic
1060843621 9:126816710-126816732 GGGCTGGAGGGGTAGGCCTTAGG + Intronic
1060943222 9:127555456-127555478 TGGGTGGGCGGGCTGGCTTCGGG - Intronic
1060956557 9:127645057-127645079 TGGGTGGTGGAGCAGGCATTTGG + Intronic
1061710908 9:132487027-132487049 TGGGTGGCGGGGCAGGCCTGAGG + Intronic
1062022160 9:134324947-134324969 TAGGGGGACGGGGTGGCCTTTGG + Intronic
1062084929 9:134643548-134643570 TGGGTGTGGGGGCTGCCCTGGGG + Intronic
1062284178 9:135765772-135765794 TGGGCGGAGGGGGTGGCATGGGG + Intronic
1062381298 9:136288125-136288147 GTGGGGGAGGGGCTGCCCTTGGG + Intronic
1062452661 9:136622025-136622047 GTGGTGGAGGGGCTGGCCATGGG + Intergenic
1062474365 9:136719970-136719992 CGGGTGCAGGGGCTGGTCTGGGG + Intronic
1062521399 9:136959421-136959443 TGGGTGGAGGGGCTGGACCCAGG + Intergenic
1062582058 9:137233124-137233146 TGGGTGGAAGGGCTGGGCTGGGG + Intronic
1187152849 X:16697142-16697164 GGGGAGGAGGGGGTGACCTTGGG - Intronic
1190065975 X:47242041-47242063 TGGGTGGTGGGGCTTGCCCAGGG - Intronic
1190450902 X:50579781-50579803 TGTGAGGAGGTGCTTGCCTTTGG + Intergenic
1190743499 X:53306318-53306340 GAGGTGGAGGGGCTGGCCCAGGG + Intronic
1191576711 X:62714289-62714311 TGGGGGGAGGGGCTGGCCTTGGG - Intergenic
1192562620 X:72137325-72137347 TGGGTGGAGGAGGGGGCCTCCGG + Intronic
1192564009 X:72147631-72147653 TTTGTTGAAGGGCTGGCCTTGGG - Intergenic
1195923773 X:110005390-110005412 TGGGTGGTGGGGCAGTCCTGTGG + Intronic
1195925505 X:110020694-110020716 TGGGTGGGGTGGCTGGCCACAGG - Intronic
1197092540 X:122556125-122556147 TGGCTGGAGCGGCTGGGCTCAGG - Intergenic
1197643596 X:128993320-128993342 TGGGTCGAGGGGCTCTCCTGTGG + Intergenic
1198095047 X:133371895-133371917 TGGGTGGAGTGGCTTGTGTTTGG - Intronic
1199947834 X:152681942-152681964 TGGTTGGAGGGGCTGCATTTAGG + Intergenic
1199961845 X:152786512-152786534 TGGTTGGAGGGGCTGCATTTAGG - Intergenic
1201063643 Y:10069554-10069576 AGGGTGGCGGGGGTGGCCTGGGG + Intergenic
1201187282 Y:11416522-11416544 TTGGAGGAGGGGCTGGAGTTGGG + Intergenic