ID: 1084864012

View in Genome Browser
Species Human (GRCh38)
Location 11:72041216-72041238
Sequence CAGTGGGGGTGGGGCCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 797
Summary {0: 1, 1: 0, 2: 5, 3: 82, 4: 709}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084863998_1084864012 12 Left 1084863998 11:72041181-72041203 CCCCGATCTGGGAGCGACAGCAA 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1084864012 11:72041216-72041238 CAGTGGGGGTGGGGCCCAGAGGG 0: 1
1: 0
2: 5
3: 82
4: 709
1084864000_1084864012 10 Left 1084864000 11:72041183-72041205 CCGATCTGGGAGCGACAGCAAGC 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1084864012 11:72041216-72041238 CAGTGGGGGTGGGGCCCAGAGGG 0: 1
1: 0
2: 5
3: 82
4: 709
1084863999_1084864012 11 Left 1084863999 11:72041182-72041204 CCCGATCTGGGAGCGACAGCAAG 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1084864012 11:72041216-72041238 CAGTGGGGGTGGGGCCCAGAGGG 0: 1
1: 0
2: 5
3: 82
4: 709

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084864012 Original CRISPR CAGTGGGGGTGGGGCCCAGA GGG Intronic
900409761 1:2507287-2507309 CAGTGAGGGTGGGGCCAGGATGG + Intergenic
900419400 1:2549206-2549228 CAGTGAGGGTGGGGCCCCAGGGG - Intergenic
900940217 1:5793614-5793636 CAGTGGTGGTGGTGGCCAGATGG + Intergenic
901311163 1:8270625-8270647 CGCTGGGGGTGGGGTCGAGAAGG + Intergenic
901668016 1:10837412-10837434 CAGTGGGGGTGGGGCTCTAGCGG + Intergenic
902332077 1:15735598-15735620 CAGTGGGGGTGGGGGCGAGCAGG + Intergenic
902337911 1:15764559-15764581 CACTTGGGGTGTGGCCCAGCAGG + Exonic
902375800 1:16029413-16029435 CAGTGGGCAGGGGGCACAGAAGG - Intronic
902401383 1:16159381-16159403 CAGTGGCGCTGAGGCCCTGAGGG - Intergenic
902411734 1:16215867-16215889 CCGTGTGGGTGGGGACCAGGTGG + Intergenic
902545887 1:17190200-17190222 GAGTGGGGGTGGGGCCAGGCTGG + Intergenic
902585713 1:17437889-17437911 CGGGGGGGGAGGGGCGCAGAGGG + Intronic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
903126264 1:21250130-21250152 GAGTGGGGGTTGGGGCCAGTGGG - Intronic
903129838 1:21271665-21271687 CACTGGGGGAGGAGCCCAGTGGG + Intronic
903248943 1:22038193-22038215 CAGTGGGTGTGGGGGCCACGAGG + Intergenic
904001569 1:27341896-27341918 CAGTGGAGCTGGGGCCAAGCTGG + Intergenic
904375130 1:30076359-30076381 CAGCAGGGGTGGGGCCCTCATGG + Intergenic
904390208 1:30179994-30180016 CTGTGAGGGTGGGGCAAAGACGG + Intergenic
904591669 1:31618406-31618428 CAGTGGGGGTGGTGCGCGGAGGG - Intronic
905894727 1:41538112-41538134 CAGTGGGGGTGGGTGTCAGGTGG + Intronic
906279346 1:44542878-44542900 GAGTGGGGCTGGGGGCCGGAGGG + Intronic
906661163 1:47583334-47583356 CACTGGCGGGGGGCCCCAGAGGG - Intergenic
907069067 1:51518502-51518524 CATTGGGGGTCTGACCCAGAAGG + Intronic
907275606 1:53315111-53315133 CAGGAGGGGTGGGGTGCAGAAGG - Intronic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907336093 1:53700543-53700565 GCGTGAGGGTGGGTCCCAGAAGG + Intronic
907470767 1:54672055-54672077 CAGTGTGACTGGAGCCCAGAGGG + Intronic
907697083 1:56742058-56742080 CAGTGGGGCTGGGGGGCGGATGG + Intronic
908573357 1:65433160-65433182 GAGTAGGGGTGGGGGGCAGAGGG - Exonic
909673278 1:78212177-78212199 CAGCTGGGGTGGGGCACTGATGG - Intergenic
910716345 1:90235727-90235749 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
911508438 1:98783538-98783560 AATTGGGGGTGGAGCCAAGATGG + Intergenic
912004354 1:104878606-104878628 CCGTAGGGGTGGGGCCCTTATGG + Intergenic
912043072 1:105416771-105416793 CTGTAGGGGTGGGGCCCTCATGG + Intergenic
912453536 1:109783059-109783081 CAGCGGGGGTGGGGGCCAGCTGG - Intergenic
913250575 1:116909742-116909764 TCGTGGGGTGGGGGCCCAGAGGG + Intergenic
913284937 1:117217591-117217613 CATTTGGGGTGGAGCCAAGATGG + Intergenic
914221501 1:145686238-145686260 CAGTGGGGGTGGGGGGCACTGGG - Intronic
914474064 1:148009107-148009129 CAGTGGGGGTGGGGGGCACTGGG - Intergenic
914866052 1:151430026-151430048 AAGTGGGGGTGGGGGGCAGGGGG + Intronic
915245573 1:154553849-154553871 TGTTGGGGGTGTGGCCCAGAGGG + Intronic
915529160 1:156493549-156493571 CAGATGGAGGGGGGCCCAGAAGG + Intronic
915905411 1:159873284-159873306 AAATGGGGCTGGAGCCCAGAGGG - Intronic
916061210 1:161099651-161099673 CAGTGGGCAGGGGTCCCAGAAGG + Exonic
916140441 1:161692856-161692878 CAAGGGGGGAGGGGCCAAGATGG + Intergenic
916412422 1:164559325-164559347 GAGTGGGGGTGGGGGGCAGCGGG + Intronic
916486758 1:165266393-165266415 CAGTGTGGCTGGGGCAAAGATGG + Intronic
916497276 1:165356854-165356876 CAGAGGCGGAGGGGCTCAGAGGG - Intergenic
916903684 1:169257573-169257595 CAGAGGGGGAGGAGCCAAGATGG - Intronic
917194891 1:172454732-172454754 AACTGGGGGTGGGGCAGAGAGGG - Intronic
917307507 1:173641414-173641436 CACTGAGGGTCAGGCCCAGAGGG + Intronic
917582455 1:176392382-176392404 TAAGGGGGGTGGGGCCAAGATGG - Intergenic
918070530 1:181130769-181130791 CAGTGGAGGAGGGGCACAGCTGG + Intergenic
918786196 1:188768178-188768200 ATGTGGGGGAGGGGCCAAGATGG + Intergenic
919027332 1:192192581-192192603 CAGTGGGGGTGGGGTAGGGATGG + Intergenic
920259505 1:204679308-204679330 CAGAGGTGGTGATGCCCAGAAGG - Intronic
920506311 1:206517872-206517894 GGGTGGGGGAGGGGCCCATAAGG - Intronic
920805024 1:209224872-209224894 CAGTGTGGTTGGAGCACAGAGGG - Intergenic
921190004 1:212700163-212700185 CCGGGGGGGTGGGGACCAGGGGG + Intergenic
921404670 1:214765480-214765502 CAGCTGATGTGGGGCCCAGAGGG - Intergenic
921405267 1:214772210-214772232 CAGTGGAGGTGGGGCCTGGTGGG - Intergenic
921794792 1:219329893-219329915 CAGAGGGGGTGGGGGCGAGGAGG - Intergenic
921914586 1:220593586-220593608 CAGTAGGGGTGGGGCTCTGTGGG - Intronic
922958524 1:229625741-229625763 CGGTGGGGGTGGGGCGCGGGAGG - Intronic
923687393 1:236162817-236162839 CTGTGGGGGTGGGGCCCTCATGG + Intronic
923942716 1:238845148-238845170 TACCGGGGGTGGGGCCAAGATGG - Intergenic
924806603 1:247366524-247366546 CTGCAGGGGTGGGGCCCCGATGG + Intergenic
1064137537 10:12763940-12763962 CTGTGGGGGTGGGGGCCACAGGG - Intronic
1064532943 10:16328917-16328939 TATTGGTGGTGGGGCCCAGTGGG - Intergenic
1065020920 10:21500920-21500942 CAGTGGGGCTTTGGGCCAGAAGG + Intergenic
1065101656 10:22336809-22336831 CGGTGGGGGCAGGGCCCAGCCGG - Intergenic
1065998274 10:31080125-31080147 CAGTGGGGGTCTGGGCCACAGGG - Intergenic
1067089858 10:43261101-43261123 CAGAGGGGGCGGGGCCGAGGGGG - Intronic
1067523215 10:47023202-47023224 CAGGGAGTGTGGGGCTCAGAAGG + Intergenic
1067684509 10:48458474-48458496 CAGTGTGGGTGAGGCGCAGACGG + Intronic
1067941901 10:50663597-50663619 AAGTGGGGGTGGGGGCCAAGGGG + Intergenic
1068632768 10:59314679-59314701 AAGTGGGGGTGGGGTCCAAGGGG - Intronic
1069240184 10:66129426-66129448 CAGCCAGGGTGGAGCCCAGAGGG + Intronic
1069594163 10:69659867-69659889 CACTGGGGGAGGGGCCCTGGGGG - Intergenic
1069657690 10:70102204-70102226 CCTTGGGGGTGGGACACAGAGGG + Intronic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1070793333 10:79202729-79202751 CAGTGGGAGCTGGGCCCAGCAGG - Intronic
1070863144 10:79688548-79688570 AAGTGGGGGTGGGGGCCAAGGGG + Intergenic
1071208534 10:83312033-83312055 GAGTGGGGGTGGGGCAGAGGTGG - Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1072693492 10:97586723-97586745 GAGTGGGTGGGTGGCCCAGAAGG - Intronic
1073176521 10:101560535-101560557 AAGTGGGGGTGGGGGCCCCAGGG + Intergenic
1073490213 10:103848307-103848329 CAGGAGGGGTGGGACCCAGCTGG + Intronic
1073716500 10:106114385-106114407 ATGTGGGGGAGGGGCCAAGATGG + Intergenic
1073827056 10:107336468-107336490 CAGTGGTGATGGGACCCACAGGG - Intergenic
1073848327 10:107585486-107585508 CTGTGGAGAGGGGGCCCAGAAGG + Intergenic
1074003228 10:109393181-109393203 CACTGGGGGTGGAGCCAAAATGG + Intergenic
1074044588 10:109825814-109825836 CAGAGGGGGAGGAGCCAAGATGG + Intergenic
1074151037 10:110759994-110760016 CAGTGGTGGTGGGGGGCACAGGG + Intronic
1074179154 10:111043137-111043159 GATTGGGGGTGGAGCCAAGATGG + Intergenic
1074726541 10:116315935-116315957 CAGTGGAATTGGGGCACAGATGG - Intergenic
1074765755 10:116698948-116698970 CAGTGAAGGTGGGGCCTGGAGGG - Intronic
1074819603 10:117168354-117168376 GAGTGGGGATGGAGCCCCGAGGG - Intergenic
1075470803 10:122687724-122687746 CATTGGAGGTGGGGCCTGGAGGG - Intergenic
1076193633 10:128499742-128499764 CAGGTGGGGAGGGGCCCAGCAGG + Intergenic
1076242871 10:128923074-128923096 CAGTGGGGCGGGGACCCAAATGG + Intergenic
1076671652 10:132124158-132124180 CACTGGGGTGGGGGCCCAGCAGG + Intronic
1076683522 10:132186887-132186909 GGGTGGGGGCGGGGCCCAGCGGG + Exonic
1076747332 10:132521077-132521099 CAGTGAGGACGGGGCCCAGGAGG - Intergenic
1076810669 10:132884829-132884851 CAGGGTGAGGGGGGCCCAGAGGG - Intronic
1076849410 10:133085818-133085840 CAGCGGGGGAGGGGCCCTGGGGG + Intronic
1076853198 10:133103066-133103088 CACTGGGGGTGGGGCAGAGGGGG + Intronic
1076932912 10:133545755-133545777 AAGTGGGGGAGGGGCCAAGATGG + Intronic
1077269354 11:1667779-1667801 CTGTGGTGGTGCAGCCCAGAAGG + Intergenic
1077561338 11:3263606-3263628 CAGTGGGGCTGAGGCCCCCAGGG - Intergenic
1077567234 11:3309435-3309457 CAGTGGGGCTGAGGCCCCCAGGG - Intergenic
1077591918 11:3499033-3499055 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
1077956342 11:7023947-7023969 CAGTGGAGGTGGGGCCTGGTGGG - Intronic
1078095638 11:8295004-8295026 CACTGTGGATGGGGCCCAGCAGG - Intergenic
1078145799 11:8721234-8721256 GAGTGGGAGCAGGGCCCAGAGGG - Intronic
1078333610 11:10446052-10446074 CAGTGGGGGTGAGAGCTAGAGGG + Intronic
1078845398 11:15114947-15114969 CAGTGGTGGCGGGGCGCAGCTGG - Intronic
1079332642 11:19546390-19546412 CCCTGGGTGTGGGGCCCAGATGG + Intronic
1079344214 11:19637789-19637811 TGTTGGGGGTGGGGCCCAGTGGG - Intronic
1079425916 11:20342375-20342397 TCCTGGGGGTGGGGCCAAGAAGG + Intergenic
1079623439 11:22584128-22584150 TGGTGGAGGTGGGGCCTAGAGGG + Intergenic
1081443065 11:43101133-43101155 AAATGGGGGTGGAGCCAAGATGG - Intergenic
1081516141 11:43832138-43832160 CAGTGGGAGTGGACCCCTGATGG + Intronic
1081662986 11:44899805-44899827 CAGTGTGGGTGGGGCCTGTAGGG - Intronic
1082152011 11:48750697-48750719 AAGTGGGGGAGGAGCCAAGATGG - Intergenic
1082287766 11:50335471-50335493 CTGTAGGGGTGGGGCCCTCATGG - Intergenic
1082636335 11:55598586-55598608 CACGGGGGGTGGAGCCAAGATGG - Intergenic
1082684275 11:56219462-56219484 GTGTGGGGGTGGAGCCAAGATGG + Intergenic
1082956691 11:58877404-58877426 CAGAGGGAGTGGAGCCAAGATGG - Intronic
1083595086 11:63915351-63915373 CAGGGAGGTTGAGGCCCAGAAGG + Intronic
1083619815 11:64043331-64043353 CAGAGAGGGTGGGGTCCTGAGGG - Intronic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083885681 11:65572498-65572520 CAGAGGGGGTGGGGCAGAGGCGG + Intronic
1084218162 11:67662774-67662796 CAGTTGGGATGGGGCAGAGATGG + Exonic
1084247757 11:67871769-67871791 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
1084662866 11:70557462-70557484 CAGTGGGGGAGGAGCCCAGATGG + Intronic
1084825064 11:71723724-71723746 TAGCGGGGGTGGAGCCAAGATGG + Intergenic
1084864012 11:72041216-72041238 CAGTGGGGGTGGGGCCCAGAGGG + Intronic
1085023163 11:73221667-73221689 AAGAGGAGGTGTGGCCCAGAGGG - Intronic
1085031344 11:73272682-73272704 CAGTGGGGGCGGGGAGGAGATGG + Intronic
1085280207 11:75325123-75325145 CAGTGGGGGAGGTGCCAACATGG + Intronic
1086742125 11:90380645-90380667 TACTGGGGGAGGGGCCAAGATGG - Intergenic
1086771832 11:90776018-90776040 CCTAGGGGGTGGGGCCAAGATGG - Intergenic
1087068855 11:94054972-94054994 CATTGGGGCTGTGGCCCAGTTGG + Intronic
1087198518 11:95322227-95322249 CTGTGGGCTTGGTGCCCAGAGGG - Intergenic
1087370750 11:97280283-97280305 CAGTGGTGGTGGTGGCCAGAGGG + Intergenic
1087841848 11:102928548-102928570 CAGGGGAGGTGGGTCCCAAAGGG + Intergenic
1088269582 11:108020026-108020048 CAGTGGGGGTGGGGGCAGGGTGG - Intronic
1088806622 11:113358679-113358701 CAGTTGATGTGGAGCCCAGAGGG - Intronic
1089043812 11:115481214-115481236 CAGTGAGTGTGGGAACCAGATGG - Intronic
1089093175 11:115895659-115895681 GAGTGGAGGTGGGGACAAGATGG - Intergenic
1089214151 11:116825510-116825532 CAATGGTGGTGGTGCCCAGGAGG + Intergenic
1089560241 11:119340036-119340058 GAGCGGGGGAGGGGCCCAGGCGG - Intronic
1089738123 11:120563900-120563922 CACTGGAGAGGGGGCCCAGACGG - Intronic
1090684434 11:129100122-129100144 CAGTTGATGTGGAGCCCAGAAGG + Intronic
1090841097 11:130487895-130487917 CAGTGGAGGTGGGAGCTAGAGGG - Intergenic
1091273279 11:134332484-134332506 CAGTGGGGACGGGGCCGCGATGG - Intronic
1091407744 12:219919-219941 CATGGGGGGGGGTGCCCAGAGGG - Intergenic
1091588705 12:1830412-1830434 GAGTTGGGGTGGGCCACAGAGGG + Intronic
1091749795 12:3015106-3015128 CAGTGGGGAGGGGGCCAAGGGGG + Intronic
1092153125 12:6264816-6264838 CAGTGGTGGTTTGGCCCAGGAGG - Intergenic
1092280910 12:7097035-7097057 CCGTGGGGGCGGGGCCCTGCTGG - Exonic
1092418040 12:8307164-8307186 TAGCGGGGGTGGAGCCAAGATGG - Intergenic
1093005189 12:14043740-14043762 CTGTGAGGGTGGGGCACAGTGGG - Intergenic
1094436841 12:30430269-30430291 CAGTGTGGCTGGTGCCCAGTGGG - Intergenic
1095042246 12:37455728-37455750 GAGTGGGGCTGGGACCCAGCAGG + Intergenic
1095966515 12:47870725-47870747 CAGTGGAGATGGAGCCCAGAGGG - Intronic
1096343899 12:50828530-50828552 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
1096558904 12:52422062-52422084 CAATGGGGTTGGGGGACAGATGG + Intergenic
1096627500 12:52904542-52904564 CAGGGCGGGTGAGGCCCAGCAGG + Intronic
1096842230 12:54386526-54386548 AAGGGAGGGTGGGGCACAGAGGG - Intronic
1096960228 12:55569958-55569980 CTGTAGGGGTGGGGCCCTCATGG - Intergenic
1097201242 12:57280640-57280662 CAGTGGGGGAGGGGACAAAAGGG - Intronic
1097222708 12:57460238-57460260 CAGTGGGGGAGGGGGCCTGAGGG + Intronic
1098521736 12:71440655-71440677 CGGTTGGGGCGGGGACCAGATGG - Intronic
1099860831 12:88223309-88223331 TATTGGAGGTGGGGCCCAGCAGG + Intergenic
1100028008 12:90152879-90152901 TAGTGGGGGCAGGGCCAAGATGG + Intergenic
1100971963 12:100080060-100080082 CAGCAGGGGTGGGGCCCTCATGG + Intronic
1101612167 12:106302419-106302441 CACTGGGGGCGGGGCCGAGTGGG - Intronic
1101940851 12:109098080-109098102 GAGAGGGGGCGGGACCCAGAGGG + Intronic
1102390344 12:112544477-112544499 CAGTGGGGGTAGGGGAAAGAGGG + Intergenic
1102740971 12:115207295-115207317 AAGTGGGGGTGGGTGCCAGAGGG - Intergenic
1103386131 12:120534182-120534204 CAGTGGGGTTGGGGCGGAGGTGG + Intronic
1104231906 12:126893109-126893131 CTGTGGGGGTGGGGAACAAAAGG + Intergenic
1104338027 12:127918851-127918873 CAGTTGGGGTGTGGCCAAGAAGG + Intergenic
1104493341 12:129213729-129213751 CAGTGGGCGTGGGGCAGTGATGG - Intronic
1104748567 12:131224468-131224490 CATGGGGGGTGGGGCCAGGATGG + Intergenic
1104862668 12:131932324-131932346 CAGCGGGGGAGGGGCAGAGAAGG - Intronic
1104904026 12:132203992-132204014 CACTGGGGGTGGGAACCACAGGG - Intronic
1105277937 13:18947113-18947135 CAGTGGGTGTGGAGCAGAGAGGG + Intergenic
1106618908 13:31355438-31355460 CTGTAGGGGTGGGGCCCTCATGG + Intergenic
1108775552 13:53761285-53761307 CAGTGGGTGGGGAGCCTAGAGGG + Intergenic
1109323027 13:60833328-60833350 CCATGGGGGTGGAGCCAAGATGG - Intergenic
1110363854 13:74659513-74659535 GACAGGAGGTGGGGCCCAGAAGG + Intergenic
1111968123 13:94881599-94881621 CATTGGAGGTGGGGCCCGGTGGG - Intergenic
1113780491 13:112974014-112974036 CAGTGGGGGATGGGGTCAGAGGG - Intronic
1113916133 13:113875135-113875157 CAGTGGGGCTGGGCCCAAGCAGG + Intergenic
1114425834 14:22621746-22621768 CACTTGGGGTGGAGCCAAGATGG - Intergenic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1115889422 14:38010574-38010596 GACTGGAGGTGGGGCCCAGTGGG + Intronic
1116546138 14:46167264-46167286 GAGAGGGGGTGGAGCCAAGATGG - Intergenic
1117349820 14:54870361-54870383 GGGTGGGGGTGGAGCCAAGATGG + Intronic
1117950319 14:61076193-61076215 CAGAGGGAGTGGGGCCCCTAGGG + Intronic
1118478780 14:66143378-66143400 GAGAGGGGATGGGGCCAAGATGG + Intergenic
1118740638 14:68737082-68737104 CAGCTGGGGTGGGCTCCAGAGGG - Intergenic
1118740929 14:68738681-68738703 CACTGAAGGTGGGGCACAGAGGG - Intergenic
1118981216 14:70718529-70718551 CAGATTGGGTGGGGCCCTGAAGG + Intergenic
1119104053 14:71907404-71907426 CTGTGGGGCTGGGGCGTAGAAGG + Intergenic
1119142975 14:72284591-72284613 CTGTAGGGGTGGGGCCCTCATGG + Intronic
1119156423 14:72415669-72415691 CCGGGGGGGTGGAGCCAAGATGG - Intronic
1119203629 14:72777601-72777623 CTCTGGGGGTGGGGCCTAGTGGG + Intronic
1119204343 14:72782999-72783021 CAGTGAGGATGGAGCCCAGCGGG - Intronic
1120115279 14:80609459-80609481 GGATGGGGGTGGGGGCCAGAGGG - Intronic
1121014326 14:90539170-90539192 GAGTGGGGGTGGTTCCCTGAGGG + Exonic
1122142976 14:99673679-99673701 CAGAGGGGGTGGTGCACTGAGGG + Intronic
1122370224 14:101225482-101225504 TGGTGTGGGTGGGGCCCAAAGGG - Intergenic
1122744765 14:103891198-103891220 CAGTGGGTGTGGGAACCAGAGGG - Intergenic
1122988061 14:105221711-105221733 CAGTGGGGAGGGGGTCCAGCAGG + Exonic
1202940769 14_KI270725v1_random:143453-143475 GAGTGGGGTTGGGACCCAGCAGG + Intergenic
1123476130 15:20593523-20593545 CTGTGGTGGTGGGGACCAGCTGG + Intergenic
1123641882 15:22406841-22406863 CTGTGGTGGTGGGGACCAGCTGG - Intergenic
1123751906 15:23363651-23363673 GGGTGGGGGTGGTGGCCAGAGGG - Intronic
1123873353 15:24598416-24598438 CAGTGGGATGGGGGCTCAGATGG - Intergenic
1124171349 15:27376451-27376473 CTGTAGGGGTGGGGCCCTCATGG - Intronic
1124284272 15:28387575-28387597 GGGTGGGGGTGGTGGCCAGAGGG - Intronic
1124298425 15:28524039-28524061 GGGTGGGGGTGGTGGCCAGAGGG + Intronic
1125434493 15:39630518-39630540 CACTGGGGGTGGGGCATGGAGGG + Intronic
1125510999 15:40292245-40292267 GAGTTGGGGTGGGATCCAGATGG - Intronic
1126292694 15:47099793-47099815 GAGTGGGGTTGGGACCCAGCAGG - Intergenic
1126542571 15:49839349-49839371 CGGGGGGGGTGGAGCCAAGATGG - Intergenic
1126721938 15:51590943-51590965 CAAGGGGGGTGGAGCCAAGATGG + Intronic
1127042271 15:54990513-54990535 CAGGGAGGGCGGGGCCAAGATGG + Intergenic
1128083967 15:64873350-64873372 CAGAGGGGGTGGCCCACAGAAGG + Intronic
1128331167 15:66756668-66756690 CAGTGGAGATTGGGGCCAGAAGG + Intronic
1128664639 15:69529260-69529282 GAGTGGGAGTGGGGCCTGGATGG - Intergenic
1128724631 15:69979303-69979325 CAGTGTGTGTGGGTCCCAGAGGG + Intergenic
1128906334 15:71471177-71471199 GAGTGGGGATGGGTCACAGAAGG - Intronic
1129030503 15:72614608-72614630 CAGTGGTGGTGGTGGCCATAGGG - Intergenic
1129060014 15:72853246-72853268 CAGTGGAGGAGGGGCCCGGCAGG + Intergenic
1129204065 15:74024952-74024974 GGGTGGTGGTGGGGCCCAGCAGG + Intronic
1129885673 15:79035555-79035577 GAGGGGGTGTGGGGCCCAGCAGG - Intronic
1129931076 15:79411776-79411798 CAGCCTGGGTGGAGCCCAGAGGG + Intronic
1130274440 15:82469180-82469202 CAGTGGGGTTGGAGCCCTGGTGG + Intergenic
1130466787 15:84196554-84196576 CAGTGGGGTTGGAGCCCTGGTGG + Intergenic
1130497477 15:84476982-84477004 CAGTGGGGTTGGAGCCCTGGTGG - Intergenic
1130589082 15:85201147-85201169 CAGTGGGGTTGGAGCCCTGGTGG + Intergenic
1130908177 15:88254324-88254346 CAGTGGGGGAGAGGCACAGTTGG + Intronic
1131648689 15:94375290-94375312 TGGTGGAGGTGGGGCCCAGCAGG - Intronic
1131716303 15:95114194-95114216 CAGTGGTGGTGGTGGCCATAGGG + Intergenic
1131937130 15:97519095-97519117 CAGTGGGAGTGGGGAATAGATGG + Intergenic
1132500686 16:283383-283405 CAGTGGGGCTGGGGACCGGCGGG + Intronic
1132517189 16:371307-371329 CTCTGGGGGTTTGGCCCAGAAGG - Exonic
1132747754 16:1444040-1444062 CAGTGGGGGCCGGGCCCCAAGGG - Intronic
1132929329 16:2450977-2450999 CAGTGGGGCTGGGGCAGACAGGG - Intronic
1132995209 16:2819138-2819160 CAGGGGCTGTGGGGGCCAGAAGG + Intronic
1133239195 16:4404523-4404545 CAGTGGAGTCTGGGCCCAGAGGG - Intronic
1133452040 16:5911839-5911861 CCATGGGGGTGGGGCCCTCATGG - Intergenic
1133739198 16:8639155-8639177 CACTGGAGGTGAGGCCCAGGGGG + Exonic
1134489711 16:14687555-14687577 GGCTGGGGGTGGGGACCAGAAGG - Intronic
1134608020 16:15586619-15586641 CAGTGGGGCTGGGCTGCAGATGG + Intronic
1134767700 16:16775181-16775203 CAGTGGGGGAGGTTCCAAGATGG - Intergenic
1137010169 16:35313669-35313691 CAGTGAGGGTGGGGCCAGAAGGG - Intergenic
1137527101 16:49245960-49245982 CAGTGGCTGTGTTGCCCAGAGGG + Intergenic
1137800088 16:51255034-51255056 AAGTCGGGGTGGAGCCAAGATGG - Intergenic
1138722268 16:59096416-59096438 CACAGGGGGTGGAGCCAAGATGG + Intergenic
1139078626 16:63486256-63486278 CAGTGGTGGTGTGTTCCAGAAGG + Intergenic
1139951946 16:70676856-70676878 CAGTGGGGGTGGGGTTCCCAGGG - Intronic
1139961590 16:70721204-70721226 TGGTGGGGCTGGGGCCTAGAAGG + Intronic
1140201975 16:72902373-72902395 AGGTGGGGCTGAGGCCCAGAGGG + Intronic
1142225331 16:88874326-88874348 GAGTGTGGGTGGGGACAAGATGG + Intergenic
1142248687 16:88981237-88981259 CAGTTGGGGTGAGCCACAGAGGG + Intergenic
1142286491 16:89173513-89173535 TGGTGGAGGTGGGGGCCAGATGG + Intronic
1142627772 17:1203366-1203388 CCGTGGGGGCGGGGCCTTGAGGG + Intronic
1142644724 17:1304473-1304495 CAGTGAGGCTGTGGCCCAGGTGG + Intergenic
1142876230 17:2853484-2853506 GAGTGCGGGCGGGGACCAGAAGG + Intronic
1142885724 17:2911171-2911193 CAGTGAGGGTGGGGGCCCGGGGG - Intronic
1143646761 17:8235238-8235260 CAGTGGGAGGGGGGACAAGAAGG - Exonic
1143741926 17:8960831-8960853 GGCTGGGGGTGGGGCCCGGAGGG - Intronic
1144312482 17:14025500-14025522 CAGTGGGTGAGGGGACCAGGAGG + Intergenic
1144332270 17:14235825-14235847 CAGTGGGTGAGGGGACCAGGAGG - Exonic
1144801001 17:17927209-17927231 CAATGGGGGTGGAGTCCAAAGGG + Intronic
1145923717 17:28630443-28630465 CAGTGGGGGCTGGGCTCAGGTGG - Intronic
1145960425 17:28883853-28883875 TGGGAGGGGTGGGGCCCAGAGGG - Intronic
1145978413 17:28997533-28997555 CAGTGGGGGTGAGCGCCAGCTGG - Intronic
1146426266 17:32742274-32742296 CAGTGGAGGAGGGTACCAGATGG + Intronic
1146440149 17:32886925-32886947 CAGTGAGGGTGTAGCACAGAGGG - Intergenic
1147214715 17:38892485-38892507 CAGAGGTGGAGGGGCTCAGAAGG + Intronic
1147364891 17:39953080-39953102 GGGTGGGGCTGGGGCCGAGACGG + Intergenic
1147422975 17:40331793-40331815 GAGTGGGGGTGGGGCGTAGGTGG - Intronic
1147537896 17:41332854-41332876 CAGTGGGGAGGGGGCCGAGAAGG - Intergenic
1147581864 17:41631572-41631594 CACGGAGGGAGGGGCCCAGAAGG + Intergenic
1147811570 17:43173822-43173844 GGGTGGGGGTGGGGGGCAGAGGG - Intronic
1148647063 17:49225235-49225257 CAGTGGGGTTTATGCCCAGAGGG + Intronic
1148740037 17:49887563-49887585 AAGTAGGGGAGGGGACCAGAAGG - Intergenic
1150196631 17:63305508-63305530 CATAGCGGGTGGGGCCAAGATGG - Intronic
1150284873 17:63949007-63949029 CACTGGGGCTGGGGGCCAGGAGG - Intronic
1150813842 17:68377559-68377581 CAGTGGGGGTACTGCCCAGGAGG + Intronic
1151316362 17:73325054-73325076 CATTGGAGGTGGGGCGCAGAGGG - Intergenic
1151334536 17:73432140-73432162 GAGTGGGGGTGGGGTAGAGAGGG + Intronic
1152267061 17:79301295-79301317 AAGTCCGGGTGTGGCCCAGATGG - Intronic
1152559516 17:81070919-81070941 CAGTGGGGGTGGATGACAGAAGG + Intronic
1152631969 17:81414479-81414501 GAGGGGGTTTGGGGCCCAGACGG - Intronic
1152784567 17:82241120-82241142 GGGTGGGGGTGGGGGGCAGAGGG + Intronic
1152933082 17:83120141-83120163 GATTGGGGGAGGGGCTCAGAGGG + Intergenic
1153424295 18:4945428-4945450 GAATGGGGGTGGGGCTCACAGGG - Intergenic
1153664749 18:7358878-7358900 AAATGGGAGTGGGGACCAGAAGG + Intergenic
1156696452 18:39773632-39773654 TATTGGGGGTGGGGCCTAGTGGG + Intergenic
1157217806 18:45800191-45800213 CTGTGGAGGTGGAGCCAAGATGG - Intergenic
1157714272 18:49872432-49872454 AAGTGGGGGTGGGGACAGGAGGG - Intronic
1157786279 18:50485937-50485959 CAGGGGTGGTGGGGCACAAAAGG - Intergenic
1157904966 18:51561669-51561691 AAGTGGGGCTTGGGCGCAGAAGG - Intergenic
1158089174 18:53690679-53690701 GGGTGGGGGTGGGTCACAGAAGG - Intergenic
1158543066 18:58374434-58374456 CAGTGGGGAGGGGGCACAAAAGG - Intronic
1158839061 18:61364207-61364229 CATTGGGGGTGGGGCCTAATGGG + Intronic
1158988325 18:62842322-62842344 AAGTTGGGGTGGGGAACAGAGGG + Intronic
1159570827 18:70110391-70110413 CAGTGGGTGCAGGGCACAGAGGG + Intronic
1159690015 18:71476340-71476362 CAGACGGGGCGGGGCCAAGATGG + Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1160399081 18:78596068-78596090 CAGTGTGGGTGGAGCCCTGCTGG + Intergenic
1160709966 19:547007-547029 CTGTGGCTGTGGGGCCCAGTGGG + Intronic
1160865396 19:1253851-1253873 CAGAGGGGGCGGGGCCCAGCTGG - Intronic
1160880284 19:1316541-1316563 CAGTAGGGGGGGAACCCAGACGG - Intergenic
1161314507 19:3611562-3611584 CAGGCTGGGTGGGGCCCACAGGG - Exonic
1161348069 19:3777820-3777842 CACTGGGGCTGGGGCACACAGGG + Intergenic
1161428700 19:4218181-4218203 CAATGGGGGTGGGGCCCGGGTGG - Intronic
1161607169 19:5221543-5221565 CAGTGGGATTGGGGCTCAGTCGG - Intronic
1161644239 19:5443494-5443516 CAGGCACGGTGGGGCCCAGAGGG + Intergenic
1162550965 19:11357913-11357935 CAGTGTGGATGGGGCAGAGAGGG - Intronic
1162572023 19:11479646-11479668 CCCTGGGGGCGGGGCCTAGATGG + Intronic
1162926357 19:13932223-13932245 CATGGGGGGTGGGGGGCAGAAGG - Intronic
1163265356 19:16217477-16217499 CAGTGGGAGCGGGGCTCAGGTGG + Intronic
1163597101 19:18226475-18226497 CTGCGGGGGCGGGGCCCAGCGGG + Intronic
1163886290 19:19967457-19967479 TGGTGGGGGTGGGGCCAAGATGG - Intergenic
1163888175 19:19988027-19988049 TGGTGGGGGTGGGGCCCAGATGG + Intergenic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165734951 19:38170036-38170058 CAGAGGGGTTGGGGCCATGATGG + Intronic
1166007553 19:39917748-39917770 CAGAGGGGTTGGGGCCAGGATGG - Intronic
1166109354 19:40613094-40613116 CAGTGGCCGTGGGGACCACAGGG - Exonic
1166219612 19:41355995-41356017 CAGTATGGCTGGAGCCCAGACGG + Intronic
1167108549 19:47445691-47445713 TTGTGGGGGTGGGGGACAGAGGG + Intronic
1167198675 19:48048852-48048874 TGTTGGAGGTGGGGCCCAGAGGG + Intronic
1167251138 19:48398931-48398953 CAGCGGGGGCGGGGCCTAGAGGG + Intronic
1167360704 19:49028863-49028885 CAGTGCAGGTGGGGCGGAGAGGG - Intronic
1167509332 19:49887956-49887978 CAGTGGGGGTGGGGCCGCGTAGG + Intronic
1168438048 19:56337718-56337740 CAGGGCGGGTGGAGCCAAGATGG - Intronic
1168641577 19:58034621-58034643 CAGTGGGGGATGGGCCCAAGGGG - Intronic
1168721848 19:58558649-58558671 CAGTGGGGGCGGGGCCGGGCGGG - Exonic
925443689 2:3909625-3909647 AAGTGTGGGAGGGACCCAGAGGG - Intergenic
927502868 2:23593899-23593921 CAGGGAGGGAGGGGCCCTGAAGG - Intronic
927564980 2:24104254-24104276 GGGTGGGTGTGGGGCCCAGTGGG - Intronic
927570216 2:24152958-24152980 CAGTGGTGGTGGTGGCCACAGGG - Intronic
927880859 2:26689107-26689129 CAGAGGGAGAGGGGCACAGATGG - Intergenic
928024320 2:27727629-27727651 CTGTGGGGATGGGGCCACGACGG + Intergenic
929124666 2:38512386-38512408 GGCTGGGGGTGGGGCCCAGCGGG - Intergenic
929597930 2:43187671-43187693 TGGTGGGGGTGGGCCACAGAGGG + Intergenic
931653543 2:64489734-64489756 CAGAGGGGTTGGGTCCCAAAGGG + Intergenic
931694234 2:64859897-64859919 CAGCGGGGGCGGCGCCGAGAGGG + Intergenic
931949399 2:67345563-67345585 TGGTGGGGGTGGGGACCAGGAGG - Intergenic
932320536 2:70819321-70819343 CAGTGGGGGTGGGGTGCAGAGGG - Intronic
933248442 2:80001750-80001772 CAGTGGGGGTGAGGCACAGGAGG - Intronic
933250624 2:80024941-80024963 CAGTGGAAGTGGGTCTCAGAGGG + Intronic
933397557 2:81752575-81752597 CTGTTGGGGTGGGGCACAGTGGG + Intergenic
934946848 2:98548468-98548490 GAGATGGGGTGGGGCCCTGAAGG + Intronic
935938198 2:108209249-108209271 AATTGGGGGTGGAGCCAAGATGG - Intergenic
936092867 2:109512202-109512224 CAGTGGGGCCAGGGCCCAGCAGG - Intergenic
936615393 2:114042995-114043017 CAATGAGGGTGGGGCTCAGCTGG + Intergenic
937258096 2:120568873-120568895 CAGTGGGAGGGAGGCTCAGATGG - Intergenic
937543292 2:122985949-122985971 CAGTGGGACTGAGGCCCACAGGG - Intergenic
938121813 2:128639355-128639377 CAGTGGGGGTGGTGTCCTGCAGG - Intergenic
938127700 2:128686359-128686381 CAGAGAGGGTGTGGCTCAGAGGG - Intergenic
938264947 2:129921992-129922014 CAGGGGGGGTGGGGGGCAGCAGG + Intergenic
938595693 2:132785111-132785133 CAGAGGGAGAGGGGCCCACAGGG - Exonic
938659486 2:133471020-133471042 CAGGGGGGGAGGAGCCAAGATGG - Intronic
939051738 2:137315516-137315538 TAGTGGGGGAGGAGCCAAGATGG - Intronic
939893598 2:147766519-147766541 CAAGGGGGGTGGAGCCAAGATGG + Intergenic
940095092 2:149965730-149965752 AATTGGGGGTGGAGCCAAGATGG + Intergenic
940273554 2:151916188-151916210 GAATAGGGGTGGGGCCAAGATGG - Intronic
940573729 2:155472626-155472648 CAGAGGGGGAGGAGCCAAGATGG - Intergenic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941781738 2:169452778-169452800 AAATGGGGGTGGAGCCAAGATGG + Intergenic
942455959 2:176138559-176138581 GTGTGGGGGTGTGGCCCTGATGG + Intergenic
942759898 2:179385753-179385775 CAGAGGGGGAGGAGCCAAGATGG + Intergenic
942950100 2:181712325-181712347 CAGAGGGGGTGGGGCCCTCATGG + Intergenic
943153125 2:184138781-184138803 CAGCTGGTGTGGAGCCCAGAGGG - Intergenic
943309929 2:186312989-186313011 CAGAGGGGGCGGAGCCAAGATGG + Intergenic
943619119 2:190128032-190128054 CAGTAGGGGTGGCACTCAGAGGG + Intronic
946409294 2:219508401-219508423 CAGTGGGGGTGGGGACATGGTGG + Intergenic
946435049 2:219645917-219645939 AAGAGGGGGTGGGGCACAGCTGG + Intergenic
947307387 2:228762449-228762471 CAGTGGCGGTGGTACCCACAGGG + Intergenic
948262603 2:236615196-236615218 CAGTGGGTGTCGGGCACAGGTGG - Intergenic
948423820 2:237875923-237875945 CTGTGGGGCTGGGCACCAGATGG - Intronic
948436266 2:237956232-237956254 GAGTGGGGGCGGAGCCAAGAAGG + Intergenic
948459967 2:238124299-238124321 CAGTGGGGGAGGTGCCCAGAGGG + Intronic
948861347 2:240754172-240754194 TGCTGGGGGTGGGGCCCCGAGGG + Intronic
1168814618 20:728230-728252 CGGTGGGGGTGGGGAGCAGACGG + Intergenic
1168904353 20:1391881-1391903 CAGTGGCTGTGGGTCCCACAAGG - Intronic
1168925023 20:1572238-1572260 GAGTAGGGGCAGGGCCCAGAGGG + Intronic
1170737567 20:19025018-19025040 CTGTGGGGGTGGGGCCCAAGTGG - Intergenic
1171266782 20:23777504-23777526 AACTGTGGGTGGGGCCCAGTGGG + Intergenic
1171272541 20:23827978-23828000 AACTGTGGGTGGGGCCCACAAGG + Intergenic
1171536681 20:25898800-25898822 GAGTGGGGTTGGGACCCAGCAGG + Intergenic
1171804428 20:29662357-29662379 GAGTGGGGTTGGGACCCAGCAGG - Intergenic
1171936591 20:31280085-31280107 CAGCCGGTGTGGAGCCCAGAGGG + Intergenic
1171992649 20:31708563-31708585 CAGGGAGGGTGGGGCCTAAAGGG - Intronic
1172242586 20:33423267-33423289 GAGTGGGGGTGGGGTCCTGGGGG + Intronic
1172615575 20:36281461-36281483 CAATGGGTGTGTGGCCCAGAAGG + Intergenic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1173221896 20:41137982-41138004 AAGCGGGGGCGGGGCCCGGAGGG - Intronic
1173341352 20:42155416-42155438 CAGTGGGAGGGAGGCCCAGCTGG + Intronic
1173616640 20:44407487-44407509 CAGTGGTGGTGGGGCGGGGAGGG - Intronic
1173719010 20:45237042-45237064 GAGTGGGGGTGGGGGGCGGATGG - Intergenic
1173850258 20:46213248-46213270 CAGTGGGGGAGGGGACAAGGGGG + Intronic
1174181977 20:48680663-48680685 CAGTGAGGGAGGGACCCAGGTGG - Intronic
1174618575 20:51856020-51856042 CAGTGGGGGTGGGGTCTGCAAGG + Intergenic
1175222511 20:57425535-57425557 CAGCTGGGGAGGGGCCCAGATGG + Intergenic
1175833394 20:61979175-61979197 CCGTGTGGGTTGGGCACAGAAGG - Intronic
1175939522 20:62531599-62531621 CAGTGGGGCTGTGTCCGAGAGGG + Intergenic
1176026004 20:62985975-62985997 CTGTGGTTGTGGGGCCCCGAGGG - Intergenic
1176053870 20:63134629-63134651 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176053893 20:63134682-63134704 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176053902 20:63134700-63134722 GAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176053991 20:63134895-63134917 GAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054008 20:63134930-63134952 CAGGGGAGGCGGGGCCCGGAGGG + Intergenic
1176054030 20:63134983-63135005 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054048 20:63135018-63135040 CAGGGGAGGCGGGGCCCGGAGGG + Intergenic
1176054133 20:63135230-63135252 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054156 20:63135283-63135305 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054174 20:63135318-63135340 CAGGGGAGGCGGGGCCCGGAGGG + Intergenic
1176054197 20:63135371-63135393 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054206 20:63135389-63135411 GAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054253 20:63135495-63135517 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054286 20:63135566-63135588 TAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054295 20:63135584-63135606 GAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176145165 20:63562238-63562260 GGGTGGGGCTGGGGGCCAGAGGG + Intronic
1176349936 21:5785136-5785158 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1176356750 21:5905720-5905742 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1176544257 21:8183206-8183228 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1176563208 21:8366251-8366273 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1176582385 21:8543489-8543511 GAGTGGGGTTGGGACCCAGCAGG - Intergenic
1177137983 21:17327479-17327501 CAATGGGGGAGGAGCCAAGATGG + Intergenic
1178965061 21:37109072-37109094 CGGTAGGGGTGGAGCCAAGATGG + Intronic
1179232644 21:39519155-39519177 CAGTTGGGGAGGGGCTCAGGTGG + Intergenic
1179919415 21:44499576-44499598 CACTGGGGCTGTGGCTCAGAAGG + Exonic
1180083718 21:45498125-45498147 CAATGGAGGTGGGGCTCAGGGGG - Intronic
1180093146 21:45542687-45542709 CGGCGGGGGTGGGGGCCCGAGGG - Intronic
1180120598 21:45745067-45745089 CAGTGGAGAAGGTGCCCAGAGGG + Intronic
1180175152 21:46083702-46083724 CAGAGCGGGAGGGGCCCAGAGGG + Intergenic
1180265219 22:10520537-10520559 GAGTGGGGTTGGGACCCAGCAGG - Intergenic
1181570640 22:23766260-23766282 CAGCGGGGGTGGGGGCCTGGGGG + Exonic
1181631056 22:24151584-24151606 AGGTGGGGGTGGGGCTCAGAGGG + Intronic
1181689442 22:24550358-24550380 CAGTGGGGGTGTGCCTTAGAGGG + Intronic
1182686930 22:32128289-32128311 CCCTGGGGGTGGGGCCCTGGAGG + Intergenic
1182985046 22:34708283-34708305 CAGTGGGAGAGGAGCACAGAAGG - Intergenic
1183045503 22:35216404-35216426 CAGTAGGGTTGGGAGCCAGATGG - Intergenic
1183371083 22:37432910-37432932 CACAGGGGGTGGAGCCCAGGAGG + Intergenic
1183464658 22:37973544-37973566 CTGTGGGACTGGGGCCCTGAGGG + Exonic
1184458647 22:44625177-44625199 CAGAGAGGGTGGGGCCCTGTGGG + Intergenic
1184800295 22:46754892-46754914 CAGTGGGGGTGGGGAGGGGATGG - Intergenic
1203249126 22_KI270733v1_random:99444-99466 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
949717613 3:6951172-6951194 GACTGGGGGTGGAGCCAAGATGG - Intronic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
950401888 3:12775366-12775388 CAGAAGAAGTGGGGCCCAGAAGG + Intergenic
950544323 3:13629706-13629728 AAGTGGGAGAGGGACCCAGAAGG - Intronic
950566379 3:13772142-13772164 GGGTGGGGGCGGGGGCCAGAGGG + Intergenic
950681533 3:14588534-14588556 CAGTGAGGCTGGACCCCAGAAGG - Intergenic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
950916081 3:16646629-16646651 CCGTGGGGATGGGGCCAAGAGGG + Intronic
951259866 3:20495169-20495191 CAGTGGTGGTGGCGGCCACAGGG - Intergenic
951783506 3:26390749-26390771 CAGTGGGGGAGGAGCCAAGATGG - Intergenic
952331233 3:32366176-32366198 CAGTGTGGGGGGCGCACAGAGGG + Intronic
952503907 3:33989885-33989907 GAGTGGGGACGGGGCCAAGATGG - Intergenic
952702468 3:36341478-36341500 CAGTGTGGGTAGGGGCCAGGTGG + Intergenic
952984898 3:38770462-38770484 CAGTGGGGTTGTGTTCCAGAGGG + Intronic
953196248 3:40737114-40737136 CAGAGAGGGTGGGGCCAGGAAGG - Intergenic
953362355 3:42309262-42309284 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
953576973 3:44120734-44120756 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
954143246 3:48621197-48621219 CAGTGGTCATGGGGCCCACAGGG + Intronic
954146838 3:48638753-48638775 TGCTGGGGGTGGGGACCAGAGGG - Intronic
954497563 3:50979154-50979176 CACTGGGGGAGGAGCCAAGATGG - Intronic
954506222 3:51076907-51076929 GAGTGGGAGTGAGGCCAAGAAGG + Intronic
954631689 3:52051187-52051209 AGGTGGGGCTGGGGCACAGAGGG + Intronic
955829596 3:62986932-62986954 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
957867030 3:86039078-86039100 CAGAGGGGGTGGAGCCAAGATGG + Intronic
957907588 3:86578083-86578105 CAGTGGTGGTGATGCCCAAAGGG - Intergenic
957948893 3:87098373-87098395 CAGTGAGGGTGGAGCCAAGATGG - Intergenic
958522345 3:95205257-95205279 TATCGGGGGTGGGGCCAAGATGG - Intergenic
959526928 3:107388044-107388066 CAGTGGGTGGGGGTCCCAGTTGG + Intergenic
959674683 3:109021040-109021062 CAGGTGGGCTGGTGCCCAGAGGG + Intronic
960919584 3:122732868-122732890 AGGTGGGGGTGGTGCCAAGATGG + Intergenic
960944822 3:122958668-122958690 CTGGGGGACTGGGGCCCAGAGGG + Intronic
961291437 3:125849807-125849829 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
961391257 3:126553461-126553483 CAGGGGTGGTGGGGGGCAGAAGG + Intronic
961661880 3:128473337-128473359 GACTGGGGGTGGGGCCGAGGAGG + Intergenic
961895740 3:130166542-130166564 TAGCGGGGGTGGAGCCAAGATGG - Intergenic
963050806 3:141141461-141141483 CTGGGGGGGTGGAGCCAAGATGG - Intronic
963064455 3:141252618-141252640 CAGTGTAGGTGGGGCCTAGTGGG - Intronic
964142556 3:153420243-153420265 CAGTCTGTGTGGAGCCCAGAAGG - Intergenic
966347748 3:178997819-178997841 CCGTGGGGTTGGAGCCCAAAAGG + Intergenic
968434252 4:576576-576598 CGCTGAGGGTGGGGCCCAGGGGG - Intergenic
968444966 4:647657-647679 GAGTGGAGGTGGGGCCCTGGGGG - Intronic
968690726 4:1988489-1988511 CAAAGGGGGTGGGGCCCAAGGGG + Intronic
968756234 4:2417835-2417857 CAATGGGGGTGGGGGCAGGACGG + Intronic
969005858 4:4019685-4019707 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
969219688 4:5751746-5751768 CAGTGAGGGTGGGGACAAGCAGG + Intronic
969308602 4:6339528-6339550 CGATGGGGGTGGGGCACAGCAGG - Intronic
969484193 4:7462728-7462750 CACAGGGGCTGGGGCCCAGCTGG - Intronic
969640377 4:8394834-8394856 TAGTGGGTGTGTGGCCCTGACGG - Intronic
969669981 4:8584619-8584641 CAGTGGGGGAGGGGTCTTGAGGG + Intronic
969747034 4:9080575-9080597 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
969807091 4:9617605-9617627 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
970339134 4:15086179-15086201 CTGTAGGGGTGGGGCCCTCATGG - Intergenic
970442494 4:16093714-16093736 CAGTGGTGGTGGTGGCCACAAGG + Intergenic
970703483 4:18771115-18771137 CAGTCTGTGTGGAGCCCAGAAGG + Intergenic
970801317 4:19976420-19976442 CTGTAGGGGTGGGGCCCTCATGG - Intergenic
972578877 4:40377616-40377638 CAGTGGGACTGGGCCCCGGATGG - Intergenic
972849857 4:43035583-43035605 CTGTAGGGGTGGGGCCCTCATGG + Intergenic
972928492 4:44041092-44041114 CCATGGTGGTGGTGCCCAGAGGG + Intergenic
973155287 4:46943963-46943985 CAGTGGTGGTGTGGGCCAGGGGG + Intronic
973611171 4:52637172-52637194 AAGTGAGGGTAGAGCCCAGAAGG - Intronic
973986838 4:56362747-56362769 CCCTGGGGGTGGAGCCAAGATGG + Intronic
974253415 4:59419683-59419705 TTGTGGGGGTGGTGCCCAGATGG + Intergenic
974271367 4:59655670-59655692 ATGTGGGGGTGGGGCCGAGATGG + Intergenic
974494583 4:62609882-62609904 GAGTGGGGGTTGGGCAGAGAAGG + Intergenic
974917236 4:68194055-68194077 AAGTGAGGGTGGAGCCAAGATGG + Intergenic
975165608 4:71175203-71175225 AAGTGGGGGTGGAGCCAAGATGG + Intergenic
976700719 4:87966360-87966382 GAGTGGGGTTGGGGCCAAGCCGG + Intergenic
977029573 4:91864441-91864463 CATAGGGGGTGGAGCCAAGATGG - Intergenic
977573848 4:98657500-98657522 CAGTGGGGGTGCGGGGTAGAGGG - Intronic
977954585 4:103011922-103011944 CAGTGGAGGAGTGGCCCTGAAGG - Intronic
978140597 4:105313373-105313395 TAGTGGGGGTGGTTCCAAGATGG - Intergenic
978231787 4:106408576-106408598 CATTTGGGGTGGAGCCAAGATGG - Intergenic
978638234 4:110837569-110837591 GGGTGGGGGTGGGGACCAGAAGG + Intergenic
979608945 4:122670099-122670121 GAGTGGGCGTGGGGCCCAGGAGG - Intergenic
979630761 4:122900062-122900084 CAGTGGTGGTGGGGGCCGGGGGG - Intronic
980744768 4:136999915-136999937 AAGTGCAGGTGGGGCCAAGATGG - Intergenic
981237436 4:142435480-142435502 GAGGGGGGGTGGGGCCAAGATGG + Intronic
981334198 4:143550573-143550595 CAGTGGGGGTGGGGGAAAGTGGG - Intronic
981631804 4:146827346-146827368 CTGTGGGGGCGGGGCCAAGATGG - Intronic
981729753 4:147885013-147885035 CAGTGGGGGTGGAGCCAAGTGGG + Intronic
982299041 4:153860045-153860067 CAGTGGGTGTGGCCCACAGAGGG - Intergenic
982458205 4:155635568-155635590 AAGTGGGGCTGGGACCCAGGAGG + Intergenic
983448950 4:167887577-167887599 AAGTGGTGGTGGGGCCGAGCTGG + Intergenic
983972386 4:173890558-173890580 AAGTGGGGGCGGGGCCAAGATGG - Intergenic
985083825 4:186293077-186293099 GAGTTGGGGTGGGGCTCACAGGG - Intergenic
985085843 4:186311756-186311778 GAGTGGGGGTTGGGCACACAGGG - Intergenic
985183990 4:187296374-187296396 CTGTGGGGGTGGGGCCCTCATGG - Intergenic
985512218 5:319175-319197 GAGTGTGGGTGGGAGCCAGAGGG + Intronic
985552363 5:540236-540258 GAGCGGGTGAGGGGCCCAGAGGG - Intergenic
985577844 5:681973-681995 CTGTGGGGTTGGGGCCAAGGTGG - Intronic
985592778 5:774117-774139 CTGTGGGGTTGGGGCCAAGGTGG - Intergenic
985747372 5:1654932-1654954 TGGTGGGGGTGGGGCCAAGCTGG - Intergenic
985937605 5:3108719-3108741 CAGTGTGGGTAGGGCAGAGACGG - Intergenic
985957631 5:3276755-3276777 AAGCGGGGGTGGGACCCACACGG + Intergenic
986637290 5:9835738-9835760 CTGTGGGAGAGGGGCCCAGCAGG - Intergenic
986754707 5:10824329-10824351 CAGATGATGTGGGGCCCAGAGGG - Intergenic
987182591 5:15384151-15384173 CTGTGGGAGTGAGGCCCACAAGG - Intergenic
988163964 5:27559465-27559487 CACTGGGGATAGGGCCAAGAAGG + Intergenic
988336340 5:29913599-29913621 CAGCTGATGTGGGGCCCAGAGGG + Intergenic
988649436 5:33131929-33131951 CTGAGGGGGTGGGGCCCTCATGG + Intergenic
989758378 5:44983888-44983910 AATTTGGGGTGGGGCACAGAGGG - Intergenic
989809652 5:45658437-45658459 CAGAGGGGGAGGAGCCAAGATGG + Intronic
990367036 5:55081484-55081506 CAGCGGGGGTGGAGCCAAGATGG - Intergenic
991304633 5:65164014-65164036 CAGAGGGGGAGGAGCCAAGATGG + Intronic
991637811 5:68723744-68723766 CAGTGGAGGTGGGGCCTGGTGGG - Intergenic
992328917 5:75695695-75695717 AAGTGGGGGAGGAGCCAAGATGG + Intronic
993098249 5:83505771-83505793 CTGTAGGGGTGGGGCCCTCATGG - Intronic
993117376 5:83734400-83734422 GATTGGGGGTGGGGCCAAGATGG - Intergenic
993353752 5:86881201-86881223 CATTGTGGGTGGGGCCCAGTGGG - Intergenic
994274660 5:97821811-97821833 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
994660055 5:102642234-102642256 CAGTGGTGGTGGTGGCCACAGGG + Intergenic
995050766 5:107700266-107700288 CAGGAGGGGTAGGCCCCAGATGG + Intergenic
995264307 5:110139676-110139698 TAGAGGGGGTGGGGCCAAGATGG - Intergenic
996013136 5:118502894-118502916 AAATGGGGGTGGAGCCAAGATGG - Intergenic
996196355 5:120611714-120611736 CTGCAGGGGTGGGGCCCACATGG + Intronic
996348775 5:122515621-122515643 CACTGGGGGAGGAGCCAAGATGG - Intergenic
996663075 5:126027117-126027139 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
996935515 5:128943737-128943759 AACTGGGGGTGGAGCCAAGATGG - Intronic
998168333 5:139857111-139857133 CAGGGGGAGTGGGCCCCAGAAGG - Intronic
998224850 5:140319033-140319055 CAGCGTGGCTGGGGCCTAGAGGG - Intergenic
999228885 5:150049788-150049810 CAGTGGGCTTGTTGCCCAGATGG - Intronic
999843366 5:155452581-155452603 CAGTGGGGGTGGGGTCTGGGGGG - Intergenic
1001301211 5:170535157-170535179 CAGTGGGGGTGAGGCACACTTGG - Intronic
1001579819 5:172790952-172790974 CAGTGGGGGTGGGGGATGGAGGG - Intergenic
1002196285 5:177503458-177503480 CAGTGGGGGCGGGGTGCAGGTGG - Intronic
1002327056 5:178416475-178416497 CCGGAGGGGTGGGGCCCAGGAGG + Intronic
1002556890 5:180048929-180048951 AAGAGGGTGTGGGGCACAGAAGG - Intronic
1002612697 5:180431906-180431928 CAGTGGGGAGGGGACCTAGATGG + Intergenic
1002644207 5:180645274-180645296 CCGTGGGGGTGGAGACCAGGAGG + Intronic
1002644820 5:180647976-180647998 CCCTGGAGGAGGGGCCCAGAGGG - Intronic
1002661973 5:180797427-180797449 AAAGGGGGGGGGGGCCCAGAGGG + Intronic
1002930531 6:1631497-1631519 CAGTGGTGGTGGGGCGGAGGGGG - Intronic
1004506811 6:16253595-16253617 CAGTGGAGGTGGGGCCTGGTGGG - Intronic
1004825114 6:19411516-19411538 CAGTAGTGGTGGGGAGCAGAGGG - Intergenic
1005101933 6:22180856-22180878 CAGAGGGGGAGGAGCCAAGATGG - Intergenic
1005355473 6:24979191-24979213 CAGTGGGAGTGGAGCAGAGAGGG - Intronic
1005826130 6:29632761-29632783 CAGTGGGCGCAGGGCCCAGCTGG - Intronic
1005940839 6:30558160-30558182 CCATGGGGGGAGGGCCCAGAAGG - Exonic
1006255571 6:32829650-32829672 CAGTGCGGGGAGGGCCCAGTGGG + Intronic
1006328509 6:33372425-33372447 CTGGGAGGGTGGTGCCCAGATGG + Intergenic
1006338277 6:33432111-33432133 AAGTTGGGGAGGGGGCCAGAAGG - Intronic
1006612025 6:35299789-35299811 AAGTGGGGGTGGGGCGGAAATGG + Intronic
1006639177 6:35480258-35480280 CCGTGGGTGAGGGGCCCAGGAGG + Intronic
1007155215 6:39736402-39736424 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
1008874202 6:56307853-56307875 AAGAGGGGGTGGAGCCAAGATGG - Intronic
1010842235 6:80659737-80659759 CAGTGTGGCTGGGGCCAGGAGGG + Intergenic
1011066595 6:83333949-83333971 CAGGGGGGGAGGAGCCAAGATGG + Intronic
1011264454 6:85500386-85500408 CATTGGAGGTGGGGCCTAGTAGG + Intergenic
1012821915 6:104095441-104095463 AAGCGGGGGTGGAGCCAAGATGG + Intergenic
1012844638 6:104374604-104374626 AAGGGGGGGTGGAGCCAAGATGG + Intergenic
1013396531 6:109746548-109746570 CCCTGTGGCTGGGGCCCAGAGGG + Intronic
1014120611 6:117721291-117721313 TAGTGGGGGAGGAGCCAAGATGG + Intergenic
1014529635 6:122543334-122543356 AGGAGGGGGTGGGGCCAAGATGG - Intronic
1016122766 6:140364250-140364272 CTGTAGGGGTGGGGCCCTCATGG + Intergenic
1016423944 6:143913980-143914002 CATTGGGAGAGGGGCCAAGATGG - Intronic
1017711318 6:157170688-157170710 CAGTGGGGAGGGGGCGCTGATGG + Intronic
1017924764 6:158901391-158901413 CAGTGGTGGTGGTGGCCACATGG - Intronic
1017988887 6:159469334-159469356 CAGTGGGGCTGATGCACAGATGG - Intergenic
1018788834 6:167130933-167130955 CGGAGGGAGGGGGGCCCAGAGGG - Intronic
1019031733 6:169019139-169019161 GACTGGGGATGGGGCCCAGGTGG - Intergenic
1019044444 6:169132318-169132340 CAGTGGTGGTGGCGGCCACAGGG + Intergenic
1019113648 6:169738725-169738747 AACTAGGGGTGGGGCCAAGACGG - Intergenic
1019328910 7:453113-453135 AAGAGGGGCTGGGGCCCAGGTGG + Intergenic
1019422102 7:955196-955218 GAGTGGGAGGGGTGCCCAGAGGG - Intronic
1019499959 7:1359916-1359938 CTGTGGGTGTGGGGCCCACCAGG + Intergenic
1019517148 7:1445073-1445095 CCGTGGGAGTGGGGGCCAGGCGG + Exonic
1019529397 7:1495966-1495988 CAGCTGGGGTGAGGCCCGGATGG + Intronic
1019712943 7:2525619-2525641 GAGTGGGGGTGGGACCGTGAGGG + Intronic
1021156299 7:17215214-17215236 AAGCGGGGGTGGAGCCAAGATGG + Intergenic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1022108303 7:27212626-27212648 CAGAGGGTGTGGGGCCTAGAGGG + Intergenic
1022563163 7:31371086-31371108 CATTGGGGCTGGGGCCAAGGGGG - Intergenic
1022862529 7:34382974-34382996 CTGTGGGGGTGGGACCCTCATGG + Intergenic
1023834368 7:44059670-44059692 CACTGGGGCTGGGGCCAGGAAGG + Intronic
1023863279 7:44227595-44227617 CAGGGGGTGTGGGGGACAGAGGG + Intronic
1024557506 7:50615965-50615987 CAGTGGGGGTGGGGCTAGGCAGG + Intronic
1025211608 7:57022338-57022360 CACTGGGGCTGGGGGCCACATGG - Intergenic
1025660348 7:63554489-63554511 CACTGGGGCTGGGGGCCACATGG + Intergenic
1028065150 7:86375394-86375416 CCTTGGGGGTGGAGCCAAGATGG + Intergenic
1028996376 7:97104963-97104985 CAGAGGGAGTGGGGTCCTGAAGG + Intergenic
1029096045 7:98085864-98085886 CAGTGGGAGTGGGGGCCTGCTGG + Intergenic
1029674825 7:102061338-102061360 CACTGGGGCTGGGGGCCACATGG - Intronic
1029850227 7:103453959-103453981 TGGTGGGGGTGGAGCCAAGACGG - Intergenic
1031160893 7:118166749-118166771 TAATGGGGGTGGGAGCCAGATGG + Intergenic
1031233014 7:119134498-119134520 TATTGGAGGTGGGGCCTAGAGGG - Intergenic
1031352614 7:120753617-120753639 AAATGGGGGTGGGACACAGAGGG + Intergenic
1032508805 7:132455754-132455776 GTGGGGGAGTGGGGCCCAGATGG + Intronic
1032517537 7:132518360-132518382 CAGTGTGGGTGGGGCCTGGTGGG + Intronic
1033871771 7:145762744-145762766 CTGTAGGGGTGGGGCCCTCATGG + Intergenic
1034277764 7:149831085-149831107 AGGTGGGGGTGGGGCACAGGAGG - Intergenic
1034425236 7:151010519-151010541 CAGTGGGGGAGGGGTCAAGAAGG + Intronic
1034831822 7:154315292-154315314 CATTGGGGGTTTGGCCCAGCAGG + Intronic
1035386869 7:158478865-158478887 CAGTGGGAATGGGGCAAAGATGG + Intronic
1036263546 8:7258095-7258117 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036264847 8:7265717-7265739 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036266148 8:7273339-7273361 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036267449 8:7280961-7280983 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036268751 8:7288583-7288605 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036270055 8:7296205-7296227 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036297841 8:7550850-7550872 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036299145 8:7558498-7558520 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036300450 8:7566148-7566170 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036301753 8:7573792-7573814 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036303050 8:7581441-7581463 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036315587 8:7716634-7716656 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036316895 8:7724282-7724304 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036318202 8:7731930-7731952 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036319511 8:7739578-7739600 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036320818 8:7747225-7747247 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036322128 8:7754873-7754895 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036323437 8:7762521-7762543 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036324732 8:7770168-7770190 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036351302 8:8014139-8014161 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036352607 8:8021785-8021807 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036353899 8:8029433-8029455 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036975302 8:13404429-13404451 CACTGGGGTAGGGGGCCAGAAGG + Intronic
1037608736 8:20458875-20458897 GAGTGGGTGTGGGGCCCAGCAGG - Intergenic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1037647649 8:20807991-20808013 CATTGAAGGTGGGGCCTAGAGGG + Intergenic
1037689478 8:21170357-21170379 CAGTGGGGGCTGGGTCCAGTAGG - Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037865262 8:22438176-22438198 AAGTGGGGGTGGGGACACGAAGG + Intergenic
1038243449 8:25831586-25831608 CGGTGGGGGCAGGGCCAAGATGG - Intergenic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039145107 8:34438422-34438444 CAGTGGGGGTAGCCCACAGAGGG + Intergenic
1040629892 8:49198145-49198167 CAGTCAGGGTGGGGGCCAGTTGG + Intergenic
1040810843 8:51451450-51451472 CACTGGAGGTGGGACTCAGAAGG - Intronic
1041146402 8:54880875-54880897 CAGGGTGGGAGGGACCCAGACGG - Intergenic
1041211958 8:55560368-55560390 CAGAGGGGGCGGGGCCAAGATGG - Intergenic
1041914391 8:63125445-63125467 CAGTAGGGGTAGAGCACAGAGGG - Intergenic
1042631498 8:70821539-70821561 CTGTAGGGGTGGGGCCCTCATGG - Intergenic
1043165948 8:76902684-76902706 CAGTTGGGGTGGGGGCCAAGAGG - Intergenic
1043171586 8:76972827-76972849 CAGTGGGGTGGGGGCCAAGATGG - Intergenic
1044395112 8:91702513-91702535 TAGTGGTGGTGGCGGCCAGAGGG - Intergenic
1044554031 8:93542592-93542614 CAATGGGGGTGTCGCCAAGATGG + Intergenic
1045264676 8:100609123-100609145 AAGTGGGGGTGGTCCCCGGAAGG - Intronic
1045385958 8:101671030-101671052 CAAGGGGGGTGGAGCCAAGATGG + Intergenic
1045480232 8:102586104-102586126 GAGTGGGGTTGGGGAGCAGAAGG - Intergenic
1045561833 8:103271534-103271556 CTGTGGGGGTGGAGCCCTCATGG + Intergenic
1045939199 8:107718074-107718096 CAGAGGGAGTGGAGCCAAGATGG - Intergenic
1045940057 8:107728443-107728465 CTGTAGGGGTGGGGCCCTCATGG - Intergenic
1045959138 8:107946504-107946526 CTGTGGGACTGGGGCACAGAAGG + Intronic
1046708779 8:117486720-117486742 TTTTGGGGGTGGGGCCAAGATGG + Intergenic
1047000977 8:120571996-120572018 CAGCGGGGGTGGGGCCGGGGAGG - Intronic
1047464552 8:125099727-125099749 TAGTGGGGGTGGGTTCCAAAGGG + Intronic
1047627217 8:126668433-126668455 CAGTGGGAGAGGAGCCCAGTGGG + Intergenic
1047845500 8:128801229-128801251 GGGTGGGGGTGGAGCCAAGATGG + Intergenic
1048151612 8:131900555-131900577 CATTGGAGGTGGGGCCTAGGTGG - Intergenic
1048266044 8:132987975-132987997 CAGTGGGGATGGTGTGCAGATGG - Intronic
1048333438 8:133486395-133486417 CAGAGCGGGTGGAGCCCAGCTGG - Intronic
1049128027 8:140810226-140810248 CAGCTGAGGTGGAGCCCAGAGGG + Intronic
1049176752 8:141197463-141197485 CAGAGGGGGTGTGGCCCTGCCGG + Intergenic
1049199785 8:141334434-141334456 CAGTGGGGCTGGGACAGAGAGGG - Intergenic
1049411554 8:142475906-142475928 CCGTGGGAGTGGGGCCTAGCCGG + Intronic
1049427556 8:142544177-142544199 CAGGAGGGGTGGGGCCCGGAGGG - Intronic
1049442576 8:142616077-142616099 CGGTTGGGGGGGGGCTCAGAGGG - Intergenic
1049611655 8:143558716-143558738 AAGTGGAGGCTGGGCCCAGAAGG - Intronic
1049797489 8:144503332-144503354 CTGTGGAGGTGGGGCTCTGACGG + Intronic
1049797794 8:144504513-144504535 CAGTGGGGCTGGGGCCAACTCGG - Intronic
1051603346 9:18896426-18896448 AAGAGGGGGAGGGGCCAAGATGG + Intronic
1052105558 9:24510397-24510419 CTGTGGGGGTGGAGCCCTCATGG + Intergenic
1052204868 9:25827458-25827480 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
1052480526 9:29019512-29019534 TAGTGGGAGTGGAGACCAGAAGG - Intergenic
1052744480 9:32426713-32426735 CAGTGGGGGTGGGGACATGAGGG - Intronic
1053054819 9:34988127-34988149 AAGTGGGGTTGGGGGCCAGGAGG - Intergenic
1054811784 9:69440913-69440935 CTGGGGGGGTGGAGCCAAGATGG - Intronic
1055024338 9:71703318-71703340 CTGTGTGGGTGGGGCACAGAGGG + Intronic
1056300632 9:85237082-85237104 CAATGGGGAACGGGCCCAGAGGG - Intergenic
1056581152 9:87888721-87888743 CTGTGGTGGTGGGGACCAGCTGG - Exonic
1056639407 9:88357764-88357786 CTATGGGGGTGGGGCCCTCATGG + Intergenic
1056836674 9:89961271-89961293 GAGTTGGGGTGGGGCCCACTTGG + Intergenic
1056891474 9:90497781-90497803 CAGATGGTGTGGGACCCAGATGG + Intergenic
1057051615 9:91928244-91928266 CAGTGGGGGACGGTTCCAGATGG - Intronic
1057083600 9:92189766-92189788 CAGAGGGTGTGGGGCCGAGCCGG - Intergenic
1057108567 9:92445089-92445111 CAGCTGGTGTGGAGCCCAGAGGG - Intronic
1057135198 9:92682501-92682523 CAATGGGCGTGGGGGCCAGATGG + Intergenic
1057313873 9:93956996-93957018 GAGTGGGGGTGGGGGGCAGGTGG + Intergenic
1057818269 9:98311679-98311701 CAGTGGGGCTGTGGGCAAGAGGG - Intronic
1058590918 9:106564920-106564942 CTCAGGGGGTGGGGCCAAGATGG + Intergenic
1059285133 9:113165907-113165929 TGGCGGGGGTGGGGCTCAGAAGG + Exonic
1059596179 9:115723560-115723582 AATTGAGGGTGGGGCCAAGATGG + Intergenic
1059732626 9:117072018-117072040 GAGTGGGGGAGGAGCCAAGATGG - Intronic
1060105216 9:120869026-120869048 CTGTGGGGGCGGGGCCTCGAGGG - Intronic
1060476181 9:123988489-123988511 GAGGTAGGGTGGGGCCCAGAGGG + Intergenic
1060512356 9:124243174-124243196 CAGAGGGAGAAGGGCCCAGACGG + Intergenic
1060657211 9:125380384-125380406 CCTTGGGGGTAGGGACCAGAGGG + Intergenic
1060722551 9:125988662-125988684 CAGTGGGGGAGGGAGCCACATGG - Intergenic
1060730882 9:126036277-126036299 CAGTGGAGGTGGGGACAAGAGGG - Intergenic
1061013087 9:127966899-127966921 AAGTGGGGGTGGGTTCCTGAAGG - Intronic
1061400525 9:130365830-130365852 TAGTGGGGGTGGGGCTGAGATGG - Intronic
1061489585 9:130937833-130937855 CAGTGGAGGTGGGGCTTGGAGGG - Intronic
1061629544 9:131863437-131863459 CAGTGGGGGCAGATCCCAGAGGG + Intronic
1061912945 9:133734603-133734625 AAGTGGGGGTCGGGGCCACAAGG + Intronic
1062127972 9:134875418-134875440 CAAGGGGGGTGGGGACCAGTGGG - Intergenic
1062133596 9:134913200-134913222 CAGTGGGAGGGAGGCCCAGGAGG + Intronic
1062282203 9:135757096-135757118 GGGTGGGGGTGGGGCCCAGCAGG - Intronic
1062335903 9:136067310-136067332 CAGTGGGGGTGGGGGAGGGATGG + Intronic
1062446542 9:136597671-136597693 CAAGGAGGGTGGGGCTCAGAGGG + Intergenic
1062479305 9:136744105-136744127 CAGTAGGGATGGCGCCCACAGGG - Exonic
1062499786 9:136847441-136847463 AAGTCGGGGTGGGGCCCTGGCGG - Exonic
1062536206 9:137022119-137022141 GAGTGGGGGCGTGGCTCAGATGG + Intronic
1062536230 9:137022204-137022226 GAGTGGGGGCGTGGCTCAGATGG + Intronic
1062538419 9:137030962-137030984 CAGTGGTGCTGGGGCCCCCACGG - Exonic
1062586216 9:137251133-137251155 TAGTGGGGGAGGGGCCCACCAGG + Intergenic
1203465525 Un_GL000220v1:82706-82728 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1203612400 Un_KI270749v1:21503-21525 GAGTGGGGTTGGGACCCAGCAGG - Intergenic
1185447701 X:268172-268194 CAGTGTGGGTGGGGCCTGCAGGG + Intergenic
1185492838 X:532023-532045 CAGTGGGGTGGGGGGCCAGAGGG - Intergenic
1186145114 X:6617084-6617106 CATTGGAGGTGGGGCCTAGTGGG + Intergenic
1187701470 X:21967983-21968005 CGGAGGGGCTGGGGTCCAGATGG + Intronic
1187889388 X:23920066-23920088 CAGTGGTGGTGGTGGCCACAAGG - Intronic
1188036142 X:25319060-25319082 AACTGGGGGTGGAGCCAAGATGG - Intergenic
1188492997 X:30755821-30755843 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
1188917812 X:35934324-35934346 CAGTGGTGGTGGCGGCCATAGGG - Intronic
1189940733 X:46117899-46117921 CAGTGGCTGTGGAGCACAGAGGG - Intergenic
1190287392 X:48970538-48970560 GTGTGGGGATGGGGCCAAGAAGG + Exonic
1190517753 X:51242662-51242684 TGGTGGAGGTGGGGCCCAGTGGG - Intergenic
1190921798 X:54860083-54860105 CACAGGGGGTGGAGCCAAGATGG - Intergenic
1191094450 X:56659579-56659601 TAGAGGGGGTGGGGACAAGATGG - Intergenic
1191117754 X:56868993-56869015 CTTGGGGGGTGGGGCCAAGATGG + Intergenic
1191157880 X:57295467-57295489 TAGAGGGGGTGGAGCCAAGATGG + Intronic
1191800494 X:65073646-65073668 CAGTTGGCGTAGAGCCCAGAGGG - Intergenic
1191827197 X:65378593-65378615 GAGTGGGGGAGGAGCCAAGATGG + Intronic
1192884153 X:75319639-75319661 CATGGGGGGTGGAGCCAAGATGG - Intergenic
1193580711 X:83259740-83259762 CAGTTGATGTGGAGCCCAGAGGG + Intergenic
1193790319 X:85808700-85808722 CAGTTGAGGTGGAGCCCAGAGGG - Intergenic
1194837563 X:98699427-98699449 CAGTGGGTGTAGCACCCAGAGGG - Intergenic
1195548307 X:106138392-106138414 CAGTTGATGTGGAGCCCAGAGGG + Intergenic
1196056383 X:111360452-111360474 TAGTGGGGGTGGGGTTGAGATGG + Intronic
1196171149 X:112590120-112590142 TAGTGGGGGAGGAGCCAAGATGG + Intergenic
1196380772 X:115086593-115086615 TATTGGGGGTGGAGCCAAGAAGG - Intergenic
1196478727 X:116121198-116121220 CAGCGGAGGTGGAGCCAAGATGG + Intergenic
1199308336 X:146293243-146293265 GAATGGGGGAGGGGCCAAGATGG - Intergenic
1199400094 X:147389273-147389295 CAGCCGGTGTGGAGCCCAGAGGG + Intergenic
1201065338 Y:10090666-10090688 CAGTGGTGCTGGGGCCTTGATGG - Intergenic
1201245922 Y:12003574-12003596 AAATGGGGGTGGAGCCAAGATGG - Intergenic
1201494341 Y:14576706-14576728 CATGGGGGGTGGAGCCAAGATGG - Intronic