ID: 1084869574

View in Genome Browser
Species Human (GRCh38)
Location 11:72088926-72088948
Sequence AGGCAGGCCTAGAGTAGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084869574 Original CRISPR AGGCAGGCCTAGAGTAGTAG AGG Intronic
901097816 1:6696485-6696507 AGGAAGGGCTAGAAGAGTAGAGG - Intronic
903366272 1:22807149-22807171 AAGCAGGCCCAGAGGAGCAGAGG - Intronic
907908194 1:58804087-58804109 AGGAAGACTTAGAGTAGTAGTGG + Intergenic
912727717 1:112074394-112074416 AGCCAGGGCTAGAGAAGGAGGGG - Intergenic
914978458 1:152389775-152389797 AGGCAGGTGTAAAGGAGTAGTGG - Intergenic
915147075 1:153801612-153801634 AGGCAGGCCTTGAGTGGCACAGG - Intergenic
915360623 1:155284424-155284446 AGGAAGGCCTGCAGTAGAAGGGG + Intronic
918312227 1:183293014-183293036 AGGCAGGCCTGGAATGGTGGTGG + Intronic
918612057 1:186504193-186504215 AGGCAGGTAAAGAGTAGAAGGGG + Intergenic
919754425 1:201058028-201058050 AGGCAGGGCTACTGTAGGAGAGG - Intronic
921187906 1:212685595-212685617 AGGCAGGCCTCCAGTAGGAAGGG + Intergenic
921955377 1:220978079-220978101 AGGCAGGCCTATAGCAGTGGTGG - Intergenic
923282928 1:232461998-232462020 AGACAGGCCTAGTGGAGGAGAGG - Intronic
1067724346 10:48757662-48757684 AGGCAGGCAAACAGAAGTAGAGG - Intronic
1071079259 10:81790545-81790567 AGACAGGCCTAGAGGAGGAAAGG + Intergenic
1073563138 10:104513996-104514018 AGCCAGGGCTGGAGTAGTTGAGG + Intergenic
1075345408 10:121678607-121678629 ATGCAGGGCTAGGGTAGGAGAGG - Intergenic
1077156693 11:1095168-1095190 AGGCACGCATGGGGTAGTAGGGG - Intergenic
1084869574 11:72088926-72088948 AGGCAGGCCTAGAGTAGTAGAGG + Intronic
1085471163 11:76758961-76758983 AGGCAGGCATAGAGCACCAGAGG + Intergenic
1087457320 11:98403411-98403433 AGGCAGGCCTCAATTAATAGGGG + Intergenic
1088522450 11:110713392-110713414 AGTCAGGACTAGAGAAGCAGTGG + Intergenic
1091200399 11:133775896-133775918 AGGCAGGGGTAGAGAAGTGGGGG + Intergenic
1098909443 12:76194112-76194134 AGGAAGCCCTAGTGTAGCAGTGG + Intergenic
1099984222 12:89644340-89644362 AGGCAGGCAAAGAGTAGAAGAGG + Intronic
1104101641 12:125618181-125618203 AGGCAGGCTGAGAATACTAGAGG - Intronic
1107006707 13:35620341-35620363 AGGTAGGCCTGGAGGAGCAGAGG + Intronic
1110060728 13:71034457-71034479 AGCCAGGACTGGAGTAGGAGAGG + Intergenic
1112965282 13:105183840-105183862 AGGCAGGGATAGAGTCTTAGTGG + Intergenic
1116770794 14:49124723-49124745 AGGCAGTCTTAGTGTAGTACAGG - Intergenic
1117153015 14:52908599-52908621 AGGCAAGACTATAGTAGCAGAGG + Intronic
1122575001 14:102736468-102736490 AGACAGGCCTAGAGAAGTTAAGG - Intergenic
1122837223 14:104436206-104436228 AGGCAGGCCTGGGGCAGTCGGGG + Intergenic
1125511975 15:40296996-40297018 AGGCAGGTCAAGAGGAGTGGGGG - Intronic
1125898976 15:43328199-43328221 ATGCAGTCCGAGAGGAGTAGTGG - Exonic
1129065623 15:72901604-72901626 AGGCAGGTCTTGAGGAGTGGAGG + Intergenic
1129230657 15:74195409-74195431 AGGCAGCCAGAGGGTAGTAGAGG + Exonic
1129239137 15:74241332-74241354 AGGCAAGCCAAGGGAAGTAGGGG + Intronic
1135301745 16:21334659-21334681 AGGCAGGCCTCGAGCTGTGGTGG + Intergenic
1142474848 17:182583-182605 TGGGAGGCCTAGAGTAGGAGTGG - Intergenic
1143014488 17:3884349-3884371 GGGCAGGCCGAGAGCAGTGGGGG - Intronic
1144028235 17:11297301-11297323 AGGGAGACCTCGAGTAGCAGTGG + Intronic
1148628361 17:49087783-49087805 GGGCAGGCCTAGAGTGCAAGAGG + Intergenic
1148684415 17:49493271-49493293 AGGCAGGTCTAGAAAAGCAGCGG + Intergenic
1151816333 17:76473221-76473243 AGGCAGGCCTGGAGTAGTGGAGG - Intronic
1153959762 18:10130818-10130840 CTGCAGGCCTAGAGTAGGAAGGG - Intergenic
1154176515 18:12089383-12089405 CAGCAGGCCTAGAGTAGCACAGG - Intergenic
1156578648 18:38349715-38349737 AGGCAGGCTTTGAGTTCTAGAGG - Intergenic
1157461756 18:47903349-47903371 AGGCAGGACTAGAGAAAGAGGGG + Intronic
1158113615 18:53970599-53970621 AGTCAGGGCCAGAGCAGTAGAGG - Intergenic
1162927058 19:13936037-13936059 AGGCAGGCCTGGGAGAGTAGGGG + Exonic
1163526566 19:17824937-17824959 GGACAGGGCTACAGTAGTAGTGG + Exonic
931425230 2:62164725-62164747 AGGCAGGACTAGAGCATGAGAGG - Intergenic
933749106 2:85591723-85591745 AGGCAGGAATAGAGTTGGAGCGG + Exonic
935217896 2:100988922-100988944 AGGGAGGCCTGGAGGAGCAGGGG - Intronic
937304819 2:120864822-120864844 AGCCAGGCTTAGAGGAGGAGGGG - Intronic
938743836 2:134258741-134258763 TGGCAGGTCGAGAGTTGTAGTGG + Intronic
940067214 2:149643488-149643510 AGGCAGGCCTTGAGCTGCAGTGG + Intergenic
940085767 2:149856728-149856750 AGGAAAGCCAAGAGTATTAGAGG - Intergenic
943764161 2:191642485-191642507 AGGCAGGGGTGGAGGAGTAGTGG - Intergenic
1169781519 20:9315535-9315557 AGGCAGACATTGAGGAGTAGGGG + Intronic
1169804321 20:9543761-9543783 ATGCAGGGCCAGAGGAGTAGAGG - Intronic
1172448899 20:35008045-35008067 GGGCTGGCCTAGGGAAGTAGTGG + Intronic
1175047182 20:56118169-56118191 AGGAAGGACTAGAGTAGGTGGGG + Intergenic
1175903732 20:62369938-62369960 TGGCAGCCCGAGAGAAGTAGGGG + Intergenic
1180899000 22:19357455-19357477 AGGCAGGCTAAGAGAAGTATGGG + Intronic
1183046961 22:35228036-35228058 AGCCTGGCCTAGAGAAGTTGTGG + Intergenic
1183077821 22:35437915-35437937 AGACAGGCCCAGAGGAGAAGGGG + Intergenic
951222583 3:20084353-20084375 ACGCAGGTCTGGAGTGGTAGGGG - Intronic
953061935 3:39434759-39434781 AGACAGGCCCAGAGTATTGGCGG - Intergenic
953062097 3:39435565-39435587 AGACAGGCCCAGAGCATTAGTGG - Intergenic
953136901 3:40189512-40189534 AGGCAAGCCTAGGGCAGGAGTGG + Intronic
954093128 3:48301232-48301254 TTGCAGGCCTAGAGAAGTAGGGG - Intronic
954719845 3:52552369-52552391 GAGCAGGCTTAGAGGAGTAGGGG - Intronic
955579127 3:60400138-60400160 AGCCAAGCCTAGAGCAGAAGAGG + Intronic
957497685 3:81011407-81011429 AGGCAGGCCTTGAGCTGTGGTGG - Intergenic
960658098 3:120028528-120028550 AGGGATGTGTAGAGTAGTAGGGG - Intronic
961817301 3:129557706-129557728 AGGCAGTACGTGAGTAGTAGTGG + Intronic
963356237 3:144211898-144211920 AGACAGGCCAAGAGAAGAAGAGG - Intergenic
963872115 3:150428325-150428347 GGGCAGGCCCAGGGTAGGAGGGG + Intronic
968355900 3:198106546-198106568 AGGCAAGCAAAGAGAAGTAGTGG - Intergenic
969362864 4:6676156-6676178 AGGCAGACCTAGAGTAGGAAAGG + Intergenic
973123758 4:46557828-46557850 AGGCAGGGGTTGGGTAGTAGAGG + Intergenic
974203988 4:58675528-58675550 GGGCAGGCCATGAGTAGTATGGG - Intergenic
976113652 4:81703363-81703385 AGCCAGTGCTAGAGAAGTAGGGG + Intronic
976311896 4:83621199-83621221 AGTCAAGCCTAGAGTGGTAATGG - Intergenic
992271996 5:75074338-75074360 AGGGAGACCTAGTGCAGTAGAGG - Intronic
996637274 5:125708629-125708651 TAGTAGGCTTAGAGTAGTAGCGG + Intergenic
1001811134 5:174629145-174629167 AGGAAGGCCTAGATTAGGGGAGG + Intergenic
1005373516 6:25158696-25158718 AGGCAGGCCTTGAGCTGTGGTGG - Intergenic
1008886702 6:56439134-56439156 AGGTAGTCCTACAGAAGTAGAGG + Intergenic
1011858631 6:91726841-91726863 AGGTAGGCCTAGAATTGTGGGGG - Intergenic
1013938632 6:115632609-115632631 AAGTAGGCCTAGAGTAGCAGAGG - Intergenic
1014080672 6:117282734-117282756 ATGCGGGCCTAAAGTAATAGAGG - Intergenic
1015630112 6:135223475-135223497 AGGCAGGCATGGAGGAGTGGGGG - Intergenic
1015983791 6:138865832-138865854 AGTCAGGCGGAAAGTAGTAGGGG - Intronic
1017022309 6:150150401-150150423 AGGCAGAACTAGTGTAGCAGGGG - Intronic
1025744060 7:64227426-64227448 AGGAAGCCCTAGAGTGATAGAGG - Intronic
1029006935 7:97220678-97220700 AGGAAGTAGTAGAGTAGTAGAGG + Intergenic
1031087194 7:117314476-117314498 AGTCAGGTCTAGAGGAGAAGGGG + Intronic
1032287576 7:130553092-130553114 AGGCAGGATAAGAGTATTAGAGG + Intronic
1033567739 7:142595962-142595984 AGGCAGGCTTAGAGCAGCAGTGG - Intergenic
1036499234 8:9297946-9297968 AAGCAGGCCTAGGGAAGCAGGGG + Intergenic
1038823854 8:30979008-30979030 AGTAAGGCCCAGAGTAGTAAAGG - Intergenic
1040286110 8:46101251-46101273 AGGCAGGCAGAGAGGAGAAGCGG - Intergenic
1040292845 8:46134270-46134292 AGGCAGGCGGAGAGGAGAAGTGG - Intergenic
1040294642 8:46142880-46142902 AGGCAGGCCTAAGGGAGAAGTGG - Intergenic
1040298721 8:46176850-46176872 AGGCAGGCATAGGGGAGAAGCGG + Intergenic
1040300579 8:46185930-46185952 AGGCAGGCAGAGGGTAGAAGTGG - Intergenic
1040305931 8:46211745-46211767 AGGCAGGCAGAGAGGAGAAGCGG + Intergenic
1040308821 8:46226101-46226123 AGGCAGGCAGAGAGAAGAAGCGG + Intergenic
1040314372 8:46253222-46253244 AGGCAGGCCGAGGGGAGAAGCGG + Intergenic
1040319752 8:46286588-46286610 AGGCAGGCAGAGAGGAGAAGTGG - Intergenic
1042439556 8:68810195-68810217 AGCCAGGCACAGAGTAGTAAGGG + Intronic
1042784244 8:72529794-72529816 AGCTATGCCTAGAGTAGAAGTGG + Intergenic
1048183743 8:132219724-132219746 AGGCAGGACAAGAGGATTAGTGG - Intronic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1050459432 9:5864690-5864712 AGGCAGGCCTGGAGAAGAAGAGG + Intergenic
1053332088 9:37221189-37221211 GGGCAGGCCTAGAGAAATACTGG + Intronic
1055333471 9:75208127-75208149 AGGCAGGCCTTGAGCTGTGGTGG + Intergenic
1055700830 9:78944127-78944149 AGGCAGGCCCAAGGTAGTACGGG - Intergenic
1057189417 9:93078113-93078135 ACGCAGGCCCAGAGCAGCAGTGG - Intronic
1058209808 9:102153241-102153263 AGGCAGGCCTTGAGCTGTGGTGG + Intergenic
1060003197 9:119977100-119977122 AGGCAGGACTAAGGTAGTAGAGG - Intergenic
1061002688 9:127911192-127911214 AGGCAGGCCAGGAGTGGTGGGGG + Intronic
1061714312 9:132509406-132509428 AGGCAGGCCTTGAGGAGCAGGGG - Intronic
1062015190 9:134287770-134287792 AGGCAGGCCCAGGGGAGAAGTGG - Intergenic
1062171638 9:135138021-135138043 AGGCAGGGGTAGAGTTGTGGGGG - Intergenic
1189273705 X:39769733-39769755 GGGCAGGCCTGGAGCTGTAGGGG - Intergenic
1189735158 X:44062785-44062807 AGCCAGTCCTAGAGCAGTGGGGG + Intergenic
1189817803 X:44841681-44841703 AGGCAGGCTTAGATTAGAAAGGG + Intergenic
1192342720 X:70277497-70277519 ATCCAGGCCTGGAGTTGTAGGGG - Exonic
1192698996 X:73447804-73447826 AGGCCGACCAAGAGAAGTAGCGG - Intronic
1194277510 X:91903844-91903866 GGCCAGGACTAGGGTAGTAGAGG + Intronic
1194383784 X:93227792-93227814 AGTGAGGATTAGAGTAGTAGAGG - Intergenic
1197714664 X:129697801-129697823 AGGCAGGCCTAGCGGAGAGGGGG - Intergenic
1199556693 X:149116780-149116802 AGACAGTCCCACAGTAGTAGTGG - Intergenic
1200594854 Y:5125933-5125955 GGCCAGGACTAGGGTAGTAGAGG + Intronic