ID: 1084870826

View in Genome Browser
Species Human (GRCh38)
Location 11:72097612-72097634
Sequence GGCCTTTGAAGCTCTGGCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 747
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 707}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084870826_1084870833 10 Left 1084870826 11:72097612-72097634 CCCTGGCCAGAGCTTCAAAGGCC 0: 1
1: 0
2: 3
3: 36
4: 707
Right 1084870833 11:72097645-72097667 GGTTCTACCCTCACTTGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084870826 Original CRISPR GGCCTTTGAAGCTCTGGCCA GGG (reversed) Exonic
901223764 1:7599952-7599974 AGCGTTGGAAGTTCTGGCCAGGG - Intronic
901626416 1:10627598-10627620 GGCCTGTGAAGACCTGGTCAGGG + Intronic
901701148 1:11045326-11045348 GGCCATTGCTGCTCTGCCCAGGG - Intronic
902707231 1:18213883-18213905 GGCCTTTGAAGTGTTGGGCAGGG - Intronic
903675114 1:25059043-25059065 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
904037533 1:27566895-27566917 GGCACTTGGAGCTCTGGGCATGG + Intronic
904932068 1:34096390-34096412 AGCGTTGGAAGCTCTGGCCAGGG + Intronic
905355109 1:37377037-37377059 GGCATTGGAAGTTCTGGCCAGGG - Intergenic
905387835 1:37616430-37616452 GGCATTAGAAGCTCTGGACTGGG - Intronic
905525072 1:38631159-38631181 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
905963225 1:42063354-42063376 AGTGTTTGAAGTTCTGGCCAGGG + Intergenic
906666856 1:47628136-47628158 GGCCCATGAAGCCCTGGGCATGG - Intergenic
907953773 1:59208639-59208661 AGTATTGGAAGCTCTGGCCAGGG + Intergenic
908658179 1:66410225-66410247 GGTGTTAGAAGTTCTGGCCAGGG + Intergenic
908866956 1:68558949-68558971 GGCCTTTTAATCACTTGCCATGG - Intergenic
909325707 1:74349008-74349030 AGCGTTGGAAGTTCTGGCCAGGG - Intronic
909396627 1:75177686-75177708 AGCGTTAGAAGTTCTGGCCAGGG - Intergenic
909446703 1:75756194-75756216 AGTGTTGGAAGCTCTGGCCAGGG + Intronic
909449372 1:75781695-75781717 AGCGTTGGAAGTTCTGGCCAGGG + Intronic
909947696 1:81682268-81682290 GGCCTTTGAATCTCAGGGAATGG + Intronic
910306843 1:85773882-85773904 GGTGTTGGAAGTTCTGGCCAGGG - Intronic
910314930 1:85871827-85871849 GGTGTTGGAAGTTCTGGCCAGGG + Intronic
910518037 1:88085746-88085768 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
910571898 1:88714784-88714806 AGCATTGGAAGTTCTGGCCAGGG - Intronic
910924409 1:92383776-92383798 AGCGTTGGAAGTTCTGGCCAGGG - Intronic
911255782 1:95631728-95631750 TGACTTTGCAGATCTGGCCATGG + Intergenic
911424132 1:97685472-97685494 AGTATTGGAAGCTCTGGCCAGGG + Intronic
911718297 1:101160862-101160884 AGTATTGGAAGCTCTGGCCAGGG + Intergenic
911943255 1:104073586-104073608 GGGCTTTGGAGCTCTGGCTGTGG + Intergenic
911966160 1:104374659-104374681 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
912636560 1:111299718-111299740 AGTGTTTGAAGTTCTGGCCAGGG + Intronic
913107388 1:115627063-115627085 GGGCTCTGAAGTTCTGGCCAGGG + Intergenic
913112474 1:115668855-115668877 GGCCTTTTAAGGTCTGGGCCTGG + Intronic
913168600 1:116211880-116211902 GGCCTTTGCATGTCTGGCCTAGG - Intergenic
913407671 1:118513791-118513813 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
913418886 1:118641883-118641905 AGTATTGGAAGCTCTGGCCAGGG + Intergenic
913425575 1:118725215-118725237 GGTATTGGAAGTTCTGGCCAGGG - Intergenic
914562324 1:148832445-148832467 AGTGTTGGAAGCTCTGGCCAGGG - Intronic
914610505 1:149297777-149297799 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
915361187 1:155287297-155287319 GGCCTTTGAGACTGTGGCCATGG + Exonic
915664764 1:157434425-157434447 GGACTGTGAGGCTCTGGCCGGGG + Intergenic
915869971 1:159548704-159548726 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
916010865 1:160704340-160704362 GGCATTTTGAGGTCTGGCCAAGG + Intronic
916010974 1:160705389-160705411 GGCATTTTGAGGTCTGGCCAAGG - Intronic
916283499 1:163078962-163078984 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
916373225 1:164122969-164122991 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
916407398 1:164510956-164510978 TGCATTTGAAGCTTTGGCCACGG - Intergenic
916924318 1:169501814-169501836 AGTGTTTGAAGTTCTGGCCAGGG + Intergenic
917259075 1:173148037-173148059 GCCCCTGGAAGCTCTGTCCAGGG + Intergenic
917678597 1:177343392-177343414 TGCCTTTGCAGCTGTGGCCCTGG + Intergenic
917682397 1:177380913-177380935 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
918125246 1:181577840-181577862 GGCCTTTGAAGCTCGTGTCAGGG + Exonic
918505894 1:185253790-185253812 GGTGTTGGAAGTTCTGGCCAGGG - Intronic
918717284 1:187805950-187805972 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
918718650 1:187824475-187824497 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
918733808 1:188033149-188033171 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
918955546 1:191202263-191202285 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
918975158 1:191474507-191474529 GGTATTAGAAGTTCTGGCCAGGG + Intergenic
919146408 1:193641422-193641444 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
919175796 1:194017384-194017406 AGTCTTGGAAGTTCTGGCCAGGG - Intergenic
919197981 1:194313342-194313364 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
919843332 1:201625005-201625027 GGCCTTTGGAGTTCAGGACAAGG + Intronic
920298264 1:204973200-204973222 GGCACTTGGGGCTCTGGCCAGGG - Intronic
920625404 1:207592574-207592596 AGTATTGGAAGCTCTGGCCAGGG + Intronic
921043557 1:211457478-211457500 AGTGTTTGAAGTTCTGGCCAGGG + Intergenic
921081686 1:211744123-211744145 ACCCTTTAAAGCCCTGGCCAGGG + Exonic
921400998 1:214723703-214723725 GGTATTGGAAGTTCTGGCCAGGG - Intergenic
921698179 1:218236458-218236480 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
922744096 1:228034468-228034490 GGCACTGGAGGCTCTGGCCAGGG - Intronic
923416383 1:233766179-233766201 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
924613781 1:245595174-245595196 GGTATTGGAAGTTCTGGCCAGGG - Intronic
1064563561 10:16616970-16616992 AGTATTGGAAGCTCTGGCCAGGG + Intronic
1064975382 10:21109010-21109032 AGCATTGGAAGTTCTGGCCAGGG - Intronic
1065074637 10:22064830-22064852 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1065603482 10:27393037-27393059 GCTCTTTCAAGCTATGGCCATGG - Intergenic
1065799248 10:29336037-29336059 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1066965418 10:42259787-42259809 AGTCTTGGAAGTTCTGGCCAGGG - Intergenic
1067731057 10:48811860-48811882 AGCATTTGAAGGGCTGGCCAAGG - Intronic
1068472963 10:57488724-57488746 GGTATTGGAAGTTCTGGCCAGGG + Intergenic
1068914352 10:62412416-62412438 GGTATTGGAAGTTCTGGCCAGGG + Intronic
1070098461 10:73361650-73361672 GGCCTTTGAAACTCAGACTAAGG - Intergenic
1070670899 10:78376515-78376537 GCCCTTTGCAGCGCTGACCAAGG - Intergenic
1071340357 10:84640974-84640996 GGTATTGGAAGTTCTGGCCAGGG + Intergenic
1072373947 10:94794918-94794940 AGTGTTGGAAGCTCTGGCCAGGG - Intronic
1072387845 10:94950319-94950341 AGTATTGGAAGCTCTGGCCAGGG + Intronic
1073027947 10:100502060-100502082 GGCCTTTGAGCCTCTGGTAAAGG + Intronic
1073544085 10:104334626-104334648 TGCCCTTGAGGCACTGGCCAAGG + Intronic
1073962743 10:108952643-108952665 AGTATTGGAAGCTCTGGCCAGGG + Intergenic
1074023866 10:109613564-109613586 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1074290651 10:112136006-112136028 TGCCTTTCAAGCTGAGGCCATGG - Intergenic
1074694513 10:116036895-116036917 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1075495822 10:122917589-122917611 GGCCTTAGGGGCTCTGGCCTGGG - Intergenic
1075631436 10:124003084-124003106 TGCCTTTGAGGCCCTGGGCAAGG + Intergenic
1075659069 10:124180852-124180874 GGCCATTGACACTATGGCCAAGG - Intergenic
1075983530 10:126763040-126763062 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
1076198613 10:128540265-128540287 GGCCTCTGGAGCCCTGACCAGGG - Intergenic
1076415677 10:130286580-130286602 GTCCTTTGAAGATATGGCCATGG - Intergenic
1077855522 11:6120547-6120569 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1078419053 11:11192841-11192863 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
1078719113 11:13867584-13867606 AGTGTTGGAAGCTCTGGCCAGGG - Intergenic
1078751634 11:14170507-14170529 AGTGTTGGAAGCTCTGGCCAGGG - Intronic
1078796441 11:14596756-14596778 AGCGTTGGAAGTTCTGGCCAGGG - Intronic
1078806957 11:14715769-14715791 AGCGTTGGAAGTTCTGGCCAGGG - Intronic
1078879831 11:15437165-15437187 GGGCTATGAAACTCTGCCCACGG + Intergenic
1079064815 11:17280461-17280483 GGCCTTTGAAACTGGTGCCATGG + Intronic
1079265265 11:18925335-18925357 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
1079579989 11:22052149-22052171 AGCATTTGAAGTTCTGGCCAGGG - Intergenic
1079683305 11:23325092-23325114 AGTCTTGGAAGTTCTGGCCAGGG + Intergenic
1079879257 11:25904035-25904057 AGTATTGGAAGCTCTGGCCAGGG - Intergenic
1079895857 11:26117622-26117644 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1080040415 11:27754103-27754125 GGCCTTTGAAGCAGCCGCCAAGG - Intergenic
1080904664 11:36529623-36529645 GGTATTGGAAGTTCTGGCCATGG + Intronic
1081251812 11:40845405-40845427 CGCATTGGAAGTTCTGGCCAGGG - Intronic
1081301341 11:41456313-41456335 AGCTTTTGGAGCTCTGGCCCTGG - Intronic
1081313536 11:41603020-41603042 AGTGTTTGAAGTTCTGGCCAGGG + Intergenic
1081461489 11:43276375-43276397 GGCCTTTCCAGCTCTTCCCAAGG - Intergenic
1082124101 11:48412066-48412088 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1082579332 11:54847117-54847139 AGTGTTGGAAGCTCTGGCCAGGG - Intergenic
1082589515 11:54988661-54988683 AGTGTTTGAAGTTCTGGCCAGGG - Intergenic
1082647955 11:55751502-55751524 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
1083527720 11:63385805-63385827 AGCATTGGAAGTTCTGGCCAGGG - Intronic
1083542753 11:63525277-63525299 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1084870826 11:72097612-72097634 GGCCTTTGAAGCTCTGGCCAGGG - Exonic
1084892516 11:72243663-72243685 GGCATTGGAGGGTCTGGCCAAGG + Intronic
1085148370 11:74224956-74224978 AGAATTTGAAGTTCTGGCCAGGG - Intronic
1086612504 11:88774461-88774483 GGTGTTGGAAGTTCTGGCCAGGG - Intronic
1087452613 11:98344142-98344164 AGTGTTGGAAGCTCTGGCCAGGG - Intergenic
1087910017 11:103741658-103741680 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1088151777 11:106754367-106754389 AGTATTGGAAGCTCTGGCCAGGG - Intronic
1089882021 11:121783437-121783459 AGTATTGGAAGCTCTGGCCAGGG - Intergenic
1090212994 11:124935965-124935987 GGCCCTGGAGGCTCTGGACAGGG + Exonic
1090720801 11:129471169-129471191 GGTATTGGAAGTTCTGGCCAGGG + Intergenic
1090928082 11:131269760-131269782 AGTATTGGAAGCTCTGGCCAGGG - Intergenic
1091185648 11:133644792-133644814 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1092031185 12:5286955-5286977 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1092710898 12:11336421-11336443 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1093188949 12:16052943-16052965 AGTATTTGAAGTTCTGGCCAGGG + Intergenic
1093982113 12:25486516-25486538 GGTATTGGAAGTTCTGGCCAGGG - Intronic
1094393308 12:29977005-29977027 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
1095128802 12:38512757-38512779 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
1095356783 12:41283989-41284011 GGTATTGGAAGTTCTGGCCAGGG + Intronic
1095559210 12:43545590-43545612 GTCCTTGGGAGCTATGGCCAGGG - Intronic
1095595689 12:43955272-43955294 GGTGTTGGAAGTTCTGGCCAGGG + Intronic
1095835905 12:46638319-46638341 GCCCCTGGAAGCTCTGCCCAGGG - Intergenic
1097056566 12:56253589-56253611 GGCCCTTGGAACTCTGACCAAGG - Intronic
1097340308 12:58429969-58429991 GGTATTGGAAGTTCTGGCCAGGG + Intergenic
1097743239 12:63270126-63270148 GCCCATGGAAGTTCTGGCCAGGG + Intergenic
1099241654 12:80146069-80146091 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1099409910 12:82312493-82312515 GGTGTTGGAAGTTCTGGCCAGGG - Intronic
1099434879 12:82631161-82631183 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1099678229 12:85789529-85789551 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1099811190 12:87584053-87584075 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1100148801 12:91710284-91710306 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1100815362 12:98381672-98381694 GGTATTGGAAGTTCTGGCCAGGG + Intergenic
1100968833 12:100044728-100044750 AGCATTGGAAGTTCTGGCCAGGG + Intronic
1101201948 12:102445744-102445766 AGCATTGGAAGTTCTGGCCAGGG - Intronic
1101218160 12:102606311-102606333 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
1101296515 12:103429098-103429120 AGCATTGGAAGTTCTGGCCAAGG + Intronic
1101343099 12:103860411-103860433 GGCATTGGAGGCTCTGGCCTAGG + Intergenic
1101746972 12:107549870-107549892 GGCCTTGGAAGCTATTGCTATGG + Intronic
1104453624 12:128891561-128891583 TGGCTGGGAAGCTCTGGCCAGGG + Intronic
1104572641 12:129938511-129938533 TGGCTTTGCAGCTGTGGCCAGGG + Intergenic
1105597979 13:21857736-21857758 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1105659274 13:22475646-22475668 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1105852250 13:24345954-24345976 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
1106608518 13:31254641-31254663 GGTATTGGAAGTTCTGGCCAGGG + Intronic
1107661249 13:42642122-42642144 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
1108160773 13:47636425-47636447 GGTATTGGAAGTTCTGGCCAAGG + Intergenic
1108860915 13:54857730-54857752 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
1108865870 13:54921855-54921877 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
1108882200 13:55133912-55133934 AGCGTTTGAAGTTCTGGCCAGGG - Intergenic
1109096871 13:58130091-58130113 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
1109573403 13:64222185-64222207 GGTATTGGAAGTTCTGGCCAGGG - Intergenic
1109731951 13:66423807-66423829 AGCATTGGAAGTTCTGGCCAGGG + Intronic
1110067661 13:71129135-71129157 GGTATTGGAAGTTCTGGCCAGGG - Intergenic
1110199324 13:72830287-72830309 GGTATTGGAAGTTCTGGCCAGGG - Intronic
1110818913 13:79891214-79891236 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
1111088063 13:83402332-83402354 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1111464942 13:88596292-88596314 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1111779008 13:92697707-92697729 AGTGTTGGAAGCTCTGGCCAGGG - Intronic
1112130720 13:96520858-96520880 AGTATTGGAAGCTCTGGCCAGGG - Intronic
1112166232 13:96922845-96922867 AGTTTTGGAAGCTCTGGCCAGGG + Intergenic
1115007723 14:28507160-28507182 AGCATTGGAAGTTCTGGCCAAGG - Intergenic
1115325544 14:32133594-32133616 GGAGTTGGAAGTTCTGGCCAGGG - Intronic
1115359612 14:32486828-32486850 AGCGTTGGAAGTTCTGGCCAGGG - Intronic
1115885478 14:37966955-37966977 GGCCTTGGGAGGTCTGGCCTTGG + Intronic
1116052494 14:39822039-39822061 AGTGTTGGAAGCTCTGGCCAGGG - Intergenic
1116137788 14:40950923-40950945 AGTGTTGGAAGCTCTGGCCAGGG - Intergenic
1116246895 14:42426851-42426873 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1116398236 14:44473201-44473223 AGTGTTGGAAGCTCTGGCCAGGG - Intergenic
1116634813 14:47381340-47381362 AGCGTTGGAAGTTCTGGCCAGGG + Intronic
1118559515 14:67063944-67063966 GGTGTTGGAAGTTCTGGCCAGGG - Intronic
1119579007 14:75757436-75757458 AGCCCTTTAAGCTCCGGCCATGG + Intronic
1120507337 14:85368947-85368969 AGTATTTGAAGTTCTGGCCAGGG - Intergenic
1120770487 14:88374004-88374026 AGTATTGGAAGCTCTGGCCAAGG + Intergenic
1121143283 14:91560715-91560737 AGTATTGGAAGCTCTGGCCAGGG + Intergenic
1121934332 14:98003209-98003231 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1122245407 14:100399589-100399611 GGCCAGTGAAGCTGTTGCCACGG + Intronic
1122806977 14:104264736-104264758 GGCTTTTGGAGCGCTGGCCCAGG + Intergenic
1123227146 15:17050808-17050830 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1123576242 15:21672508-21672530 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
1123612864 15:22114976-22114998 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
1125271763 15:37946864-37946886 AGCATTGGAAGTTCTGGCCAGGG - Intronic
1125288896 15:38123851-38123873 AGTATTGGAAGCTCTGGCCAGGG + Intergenic
1125329618 15:38569623-38569645 AGTATTGGAAGCTCTGGCCAGGG - Intergenic
1126505778 15:49402791-49402813 AGCATTGGAAGCTCTGGCCAGGG - Intronic
1126948766 15:53855306-53855328 AGTATTAGAAGCTCTGGCCAGGG - Intergenic
1127194085 15:56565533-56565555 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1127491395 15:59467720-59467742 GGTGTTGGAAGTTCTGGCCAGGG - Intronic
1127612408 15:60649843-60649865 GGCCTTTGTATCTCTGGCAACGG + Intronic
1127635486 15:60865512-60865534 GGGCATTGAGGTTCTGGCCAAGG - Intronic
1127645295 15:60952420-60952442 AGTGTTGGAAGCTCTGGCCAGGG + Intronic
1127687314 15:61361134-61361156 GGTATTGGAAGTTCTGGCCAGGG - Intergenic
1128799632 15:70489383-70489405 TCCCTTTGAATCTCTGGCCTTGG + Intergenic
1129796151 15:78377975-78377997 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1130030133 15:80306176-80306198 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1202985110 15_KI270727v1_random:406753-406775 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
1132865894 16:2092571-2092593 GGTCTGAGGAGCTCTGGCCATGG - Exonic
1133692028 16:8225140-8225162 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1134792862 16:17006249-17006271 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
1135232691 16:20724509-20724531 AGCGTTGGAAGTTCTGGCCAGGG + Intronic
1135600447 16:23778875-23778897 AGTCTTGGAAGTTCTGGCCAGGG - Intergenic
1136665948 16:31812934-31812956 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1136731105 16:32413799-32413821 AGTCTTGGAAGTTCTGGCCAGGG - Intergenic
1137677718 16:50311922-50311944 GTCCTTGGAGCCTCTGGCCAGGG - Intronic
1138702131 16:58875133-58875155 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1139266596 16:65645600-65645622 GGCCTTTGACACTTTGGGCAGGG - Intergenic
1139376333 16:66500081-66500103 AGTGTTGGAAGCTCTGGCCAGGG + Intronic
1139445636 16:66996542-66996564 GCCCTTTGAAGCACTGGGCTTGG + Intronic
1140301398 16:73760956-73760978 GTATTTGGAAGCTCTGGCCAGGG + Intergenic
1140885489 16:79239069-79239091 GTAGTTTGCAGCTCTGGCCAAGG + Intergenic
1141553419 16:84821135-84821157 GGCCTTTGGACCTCTTGCCCTGG + Intronic
1141804794 16:86335563-86335585 GGCCCCTGCACCTCTGGCCACGG + Intergenic
1142282751 16:89157049-89157071 GGCCCTTCTAGCCCTGGCCAAGG + Intergenic
1142420459 16:89966562-89966584 GGCCTTTGAACCTCAGGCCAGGG - Exonic
1202995288 16_KI270728v1_random:103471-103493 AGTCTTGGAAGTTCTGGCCAGGG + Intergenic
1203021975 16_KI270728v1_random:415813-415835 AGTCTTGGAAGTTCTGGCCAGGG + Intergenic
1144061958 17:11590969-11590991 TGCTTTTGAAGATCTGTCCAGGG + Intergenic
1145166149 17:20614608-20614630 GGCCTTTGAACCTCAGGCCAGGG - Intergenic
1145207245 17:20991137-20991159 GCCCTTGGTGGCTCTGGCCAGGG + Intergenic
1145816392 17:27798009-27798031 GGCCTGTGTAGCTCTGGCAAGGG + Intronic
1146536173 17:33654399-33654421 GGCCTTTGTAGCTCTGTGCTTGG + Intronic
1146585048 17:34075160-34075182 AGCCTATGAAGCTCTGCTCAGGG - Intronic
1147008860 17:37427596-37427618 GTCCTTCCAAGCCCTGGCCATGG + Intronic
1148188321 17:45660703-45660725 GTCCACTGAAGCTCTGTCCAAGG + Intergenic
1149166661 17:53760261-53760283 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
1150190038 17:63228940-63228962 AGTATTGGAAGCTCTGGCCAGGG - Intronic
1150388227 17:64776636-64776658 GGCCTCTGTAGGTCTGCCCAAGG - Intergenic
1150502003 17:65660079-65660101 GGACTTTGAAGCTTATGCCAAGG + Intronic
1150791229 17:68201317-68201339 GGCCTCTGTAGGTCTGCCCAAGG + Intergenic
1150798094 17:68255553-68255575 AGTCTTTGAAGGTCTGGACAGGG + Intronic
1150933828 17:69613950-69613972 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1151893895 17:76967314-76967336 GGCCTCAGAAGCCCTGGCAAGGG + Intergenic
1152175762 17:78786139-78786161 GGGCTTGGAAGCTCTGTGCAAGG + Intergenic
1152246801 17:79188835-79188857 GGCCTTGGAAGCTGCGGCCCTGG + Intronic
1152608114 17:81303113-81303135 GGCTTCTGGAGCTCTGGCCAAGG - Intergenic
1153798812 18:8650020-8650042 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
1155105406 18:22660463-22660485 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1155164598 18:23222122-23222144 GGCCCTTGAGGCTCTGGCCTTGG + Intronic
1155253664 18:23975394-23975416 AGTATTTGAAGTTCTGGCCAGGG - Intergenic
1156142929 18:34138688-34138710 AGTCTTGGAAGTTCTGGCCAGGG - Intronic
1156206613 18:34893050-34893072 GGCTTTTGAAGCTCTGTGCCAGG + Intergenic
1156887305 18:42150353-42150375 GGAGTTAGAAGTTCTGGCCAGGG - Intergenic
1157133385 18:45030022-45030044 AGCGTTGGAAGTTCTGGCCAGGG - Intronic
1157535530 18:48454616-48454638 GGCCTGTGAAGGTCTGACCTTGG + Intergenic
1157570435 18:48708819-48708841 GGCATGGGAAGCTCAGGCCATGG - Intronic
1158157289 18:54440322-54440344 GGCCTTTGAAGGTCTAGTCTTGG - Intergenic
1158308398 18:56131965-56131987 GGTATTGGAAGTTCTGGCCAGGG + Intergenic
1158921243 18:62193375-62193397 GGTATTGGAAGTTCTGGCCAGGG - Intronic
1158972001 18:62676985-62677007 AGTCTTGGAAGTTCTGGCCAAGG - Intergenic
1159383225 18:67689504-67689526 AGTGTTGGAAGCTCTGGCCAGGG - Intergenic
1161893055 19:7056561-7056583 GGCCGGTGAATCTCTGGACAGGG - Exonic
1162024759 19:7887685-7887707 CTCCCTTCAAGCTCTGGCCATGG - Intergenic
1162308210 19:9888559-9888581 GGCACTTGTAGTTCTGGCCAGGG - Intronic
1162996464 19:14338963-14338985 GGCCTCTGAGGCTCTGGGCATGG - Intergenic
1164488459 19:28684050-28684072 AGTGTTGGAAGCTCTGGCCAGGG - Intergenic
1165655489 19:37528837-37528859 GTCCCTTGGAGCTCTGGCCTGGG + Intronic
1165839836 19:38781780-38781802 AGCCTAGGAAGCTCTGGCCAGGG - Intergenic
1165973408 19:39653315-39653337 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
1166001776 19:39881761-39881783 GGTCCTTTCAGCTCTGGCCAGGG + Intronic
1166004556 19:39898012-39898034 GGTCCTTCCAGCTCTGGCCAGGG + Intronic
1166997799 19:46728108-46728130 GGGCTGTGAAGCTCTGGCCCTGG + Intronic
1167242768 19:48354832-48354854 GTCCTTTGAAGATGTGGCCTGGG - Intronic
1168666215 19:58207101-58207123 TGCCTGTGAAGCTCCGGACATGG + Exonic
1168720927 19:58554691-58554713 GGGCTGTGAAGCTCAGGACAAGG + Intronic
925170705 2:1748648-1748670 GGCTTTGGAAGCTCTGTCCCGGG + Intergenic
925441372 2:3889322-3889344 GGTATTAGAAGTTCTGGCCAGGG - Intergenic
926197181 2:10771150-10771172 TGCCTTTAAAGCTTTGGCCATGG + Intronic
926995783 2:18734299-18734321 AGTATTGGAAGCTCTGGCCAGGG + Intergenic
927479284 2:23438322-23438344 GGTGTTGGAAGTTCTGGCCAGGG - Intronic
927708399 2:25310983-25311005 GGGCTTTGAGGCTTTGACCAGGG + Intronic
927864313 2:26578946-26578968 TGCATGTGAAGCTCTGGACAAGG - Intronic
927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG + Exonic
928007355 2:27575310-27575332 ACACTTTGAAGGTCTGGCCATGG - Intergenic
929280822 2:40076312-40076334 AGTATTGGAAGCTCTGGCCAGGG - Intergenic
929367595 2:41179025-41179047 GGTATTGGAAGTTCTGGCCAGGG - Intergenic
930433751 2:51314717-51314739 AGTGTTAGAAGCTCTGGCCAGGG - Intergenic
930926159 2:56820571-56820593 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
930939517 2:56997564-56997586 GGCCCTAGAGGCTCTGTCCAGGG + Intergenic
931130523 2:59330419-59330441 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
931885393 2:66611644-66611666 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
932643939 2:73482089-73482111 GGTGTTGGAAGTTCTGGCCAGGG - Intronic
932830779 2:74987570-74987592 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
932938631 2:76136585-76136607 GGTATTGGAAGTTCTGGCCAGGG - Intergenic
932979755 2:76650010-76650032 AGTCTTGGAAGTTCTGGCCAGGG - Intergenic
933095198 2:78170279-78170301 AGTCTTGGAAGTTCTGGCCAGGG + Intergenic
933568582 2:83980512-83980534 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
933808647 2:86018230-86018252 GGCCTCTGAAGGCCTGGCCTGGG - Intergenic
934115899 2:88793154-88793176 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
934314606 2:91905457-91905479 TGTCTTGGAAGTTCTGGCCAGGG + Intergenic
934316460 2:91925169-91925191 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
935019989 2:99221012-99221034 GGTATTGGAAGTTCTGGCCAGGG + Intronic
935125343 2:100217742-100217764 GGCTGCTGAAGCCCTGGCCACGG - Intergenic
935423764 2:102898139-102898161 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
935504172 2:103879367-103879389 AGCCTTTGGAGTTCTGGGCAGGG - Intergenic
936749993 2:115630417-115630439 AGTATTTGAAGTTCTGGCCAGGG - Intronic
936784365 2:116075730-116075752 AGTCTTGGAAGTTCTGGCCAGGG - Intergenic
936806063 2:116333792-116333814 AGTGTTGGAAGCTCTGGCCAGGG - Intergenic
937455621 2:122038915-122038937 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
937982838 2:127625158-127625180 GGCCTGTGAGGCTCTGGCCAAGG + Intronic
938376613 2:130811749-130811771 GGTATTGGAAGTTCTGGCCAGGG - Intergenic
938808522 2:134829434-134829456 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
939132771 2:138257557-138257579 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
939413369 2:141861198-141861220 GGCAGTTGAAGTTGTGGCCATGG - Intronic
939704900 2:145440733-145440755 GGTGTTGGAAGCTCTGGCCAGGG + Intergenic
939890556 2:147730999-147731021 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
940093596 2:149949259-149949281 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
940272954 2:151911313-151911335 AGTATTTGAAGTTCTGGCCAGGG - Intronic
940408507 2:153333085-153333107 GGCATTTTAATCTCTGGACAGGG - Intergenic
940818952 2:158330019-158330041 AGCGTTGGAAGTTCTGGCCAGGG - Intronic
941100555 2:161290312-161290334 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
941134571 2:161698318-161698340 AGTGTTGGAAGCTCTGGCCAGGG - Intronic
941401897 2:165041564-165041586 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
942431575 2:175917059-175917081 GCCATGTGAACCTCTGGCCATGG - Intergenic
942584337 2:177458319-177458341 GGTATTGGAAGTTCTGGCCAGGG + Intronic
942744473 2:179216116-179216138 AGCGTTGGAAGTTCTGGCCAGGG + Intronic
942874986 2:180784420-180784442 AGTGTTGGAAGCTCTGGCCAGGG - Intergenic
945553943 2:211255930-211255952 AGAGTTGGAAGCTCTGGCCAGGG - Intergenic
945714934 2:213346393-213346415 GGTGTTGGAAGTTCTGGCCAGGG - Intronic
947424118 2:229967389-229967411 GGTGTTGGAAGTTCTGGCCAGGG - Intronic
1168833536 20:860822-860844 GGCCATTGATGCTGTTGCCAAGG - Intergenic
1169283276 20:4285737-4285759 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1169295170 20:4389659-4389681 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1169396663 20:5237768-5237790 AGTATTGGAAGCTCTGGCCAGGG - Intergenic
1169450379 20:5705895-5705917 GGCAGTTGAAAATCTGGCCAGGG - Intergenic
1169645850 20:7808864-7808886 AGTCTTGGAAGTTCTGGCCAGGG - Intergenic
1169671788 20:8110897-8110919 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1170197578 20:13705715-13705737 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1170482128 20:16776233-16776255 TGTCTTTGAAGCTCTAGCCAGGG - Intergenic
1170569419 20:17624623-17624645 GGCCATGGAGGCACTGGCCACGG - Exonic
1170832479 20:19854892-19854914 AGCCTTGGAAGTTCTGGCCAGGG - Intergenic
1171539607 20:25936794-25936816 AGTCTTGGAAGTTCTGGCCAGGG - Intergenic
1171801441 20:29623475-29623497 AGTCTTGGAAGTTCTGGCCAGGG + Intergenic
1171835716 20:30142847-30142869 AGTGTTGGAAGCTCTGGCCAGGG - Intergenic
1171842533 20:30232016-30232038 AGTCTTGGAAGTTCTGGCCAGGG - Intergenic
1171886665 20:30658163-30658185 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
1172630599 20:36375808-36375830 GGCCTTTTAAGCTCCAGCCTTGG - Intronic
1174880133 20:54270295-54270317 CTCCTTTGAAGCACTGACCAAGG + Intergenic
1175311205 20:58012702-58012724 GTCCTTTGATCCTCTGGCCTAGG - Intergenic
1175889104 20:62308260-62308282 GGCACATGAAGCACTGGCCATGG - Intronic
1176078107 20:63258237-63258259 TGCCTTCGAAGCTCTGGGGAGGG + Intronic
1176095758 20:63343672-63343694 GGGCTGGGAAGCCCTGGCCAGGG + Intronic
1176814960 21:13590770-13590792 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
1176915937 21:14625257-14625279 AGCGTTGGAAGTTCTGGCCAGGG + Intronic
1177111840 21:17038226-17038248 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1177181588 21:17750086-17750108 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1177524316 21:22272377-22272399 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1178033520 21:28555266-28555288 GCCCTTTGAACCTGAGGCCACGG - Intergenic
1178397693 21:32257044-32257066 TGCCTTGGAAACTCTGTCCAGGG + Intergenic
1178747819 21:35270227-35270249 AGTGTTGGAAGCTCTGGCCAGGG + Intronic
1179222963 21:39425919-39425941 GGCCACAGGAGCTCTGGCCAAGG + Intronic
1179522067 21:41952309-41952331 GGCCTTGGAAGACATGGCCATGG - Intronic
1180541374 22:16451341-16451363 AGTCTTGGAAGTTCTGGCCAGGG + Intergenic
1180987755 22:19915397-19915419 GGCCTCTGAACTGCTGGCCAAGG - Intronic
1181536452 22:23548782-23548804 GTCCTTTGATGCTATAGCCAGGG - Intergenic
1182549096 22:31091427-31091449 GGCCTGTGGAGGCCTGGCCACGG - Exonic
1183039880 22:35169779-35169801 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1184839915 22:47046521-47046543 GCCCTGTGAAGGTGTGGCCACGG + Intronic
949298003 3:2549212-2549234 GGTATTGGAAGTTCTGGCCAGGG - Intronic
949300941 3:2583207-2583229 GAGCTTTGAAGATCTGGCCATGG + Intronic
949532473 3:4969882-4969904 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
949611272 3:5706230-5706252 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
950020468 3:9783972-9783994 GGCCTTGGAGGCTGTGGCCACGG - Intronic
950925305 3:16734823-16734845 AGCATTTGAAGTTCTGGCCAGGG + Intergenic
951191635 3:19778865-19778887 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
951364882 3:21769213-21769235 GGTGTTGGAAGTTCTGGCCAGGG + Intronic
951393617 3:22137799-22137821 AGTGTTGGAAGCTCTGGCCAGGG + Intronic
952572700 3:34735996-34736018 AGTATTGGAAGCTCTGGCCAGGG + Intergenic
952607604 3:35168992-35169014 GGTATTGGAAGTTCTGGCCAGGG - Intergenic
952718437 3:36506936-36506958 AGCATTGGAAGTTCTGGCCAGGG - Intronic
954108679 3:48422495-48422517 GGGCTTTGGGCCTCTGGCCATGG - Intronic
955593791 3:60566588-60566610 AGTGTTGGAAGCTCTGGCCAGGG + Intronic
955621606 3:60870390-60870412 GGCCATTTAAGCTCTGTCTAGGG + Intronic
956668860 3:71667381-71667403 AGTATTGGAAGCTCTGGCCAGGG + Intergenic
957364098 3:79199040-79199062 AGTATTGGAAGCTCTGGCCAGGG - Intronic
957406903 3:79783492-79783514 AGTCTTGGAAGTTCTGGCCAGGG + Intergenic
958256001 3:91325530-91325552 AGCCTTTGAAGAACTGGACATGG - Intergenic
958553905 3:95649197-95649219 AGCATTGGAAGGTCTGGCCAGGG + Intergenic
958865689 3:99499038-99499060 GGCCTTGGAAACCCTGACCATGG - Intergenic
960566173 3:119134194-119134216 GGTGTTGGAAGTTCTGGCCAAGG + Intronic
960643650 3:119853931-119853953 AGCGTTGGAAGTTCTGGCCAGGG - Intronic
960752809 3:120975555-120975577 AGCGTTGGAAGTTCTGGCCAGGG - Intronic
960762836 3:121092783-121092805 GGTGTTGGAAGTTCTGGCCAGGG - Intronic
960866841 3:122210217-122210239 AGCATTGGAAGTTCTGGCCAGGG + Intronic
960986796 3:123286201-123286223 GGCCTCTGAGTCTGTGGCCAGGG + Intronic
962079581 3:132123192-132123214 AGTATTGGAAGCTCTGGCCAGGG + Intronic
962341095 3:134584188-134584210 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
962699589 3:137983954-137983976 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
963768251 3:149361337-149361359 GCACCTTGATGCTCTGGCCAGGG + Intergenic
964561500 3:158001700-158001722 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
964701355 3:159571148-159571170 AGTGTTGGAAGCTCTGGCCAGGG - Intronic
964712823 3:159689609-159689631 AGCATTGGAAGTTCTGGCCAGGG - Intronic
964890248 3:161526156-161526178 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
964964664 3:162477069-162477091 AGTATTTGAAGTTCTGGCCAGGG + Intergenic
965088689 3:164135030-164135052 AGTGTTTGAAGTTCTGGCCAGGG + Intergenic
965527289 3:169734456-169734478 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
965849690 3:173009408-173009430 GGCCTTTGTAGTCCTGGCCATGG + Intronic
965855714 3:173085527-173085549 GGTATTGGAAGTTCTGGCCAGGG - Intronic
966131143 3:176641360-176641382 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
966477926 3:180371490-180371512 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
966492183 3:180540380-180540402 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
966912461 3:184567045-184567067 GGCTTCAGAAGCTCTGGGCAAGG - Intronic
967607719 3:191467515-191467537 GGTGTTGGAAGTTCTGGCCAAGG + Intergenic
969476047 4:7422936-7422958 GGCCTTTAGAGATCTGGCCATGG - Intronic
969895837 4:10303624-10303646 GGCCTTGGAAGCTTTTGCCTTGG - Intergenic
970812095 4:20106251-20106273 GGTATTGGAAGTTCTGGCCAGGG + Intergenic
970999736 4:22308600-22308622 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
972255485 4:37350695-37350717 AGCATTTGAAGTTCTGGCCAGGG - Intronic
972677283 4:41272440-41272462 AGTGTTGGAAGCTCTGGCCAGGG - Intergenic
972755948 4:42046214-42046236 AGTATTGGAAGCTCTGGCCAGGG + Intronic
972828877 4:42791241-42791263 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
973564170 4:52167222-52167244 AGCTTTGGAAGTTCTGGCCAGGG - Intergenic
974098200 4:57387937-57387959 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
974234942 4:59168801-59168823 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
974363862 4:60919287-60919309 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
974367742 4:60974063-60974085 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
974548047 4:63337695-63337717 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
974979613 4:68938682-68938704 AGCATTGGAAGCTCTGGACAGGG + Intronic
975639191 4:76482134-76482156 AGTATTGGAAGCTCTGGCCAGGG + Intronic
975843445 4:78500713-78500735 GCCCTTTAAAGCTCTGGTGAGGG - Intronic
975898115 4:79119176-79119198 GGTATTGGAAGTTCTGGCCAGGG + Intergenic
975999523 4:80356847-80356869 AGCATTGGAAGTTCTGGCCAGGG - Intronic
976456691 4:85256213-85256235 GGCCTCAGAATCTCTTGCCAGGG - Intergenic
976940984 4:90701985-90702007 AGCGTTGGAAGTTCTGGCCAGGG - Intronic
976954666 4:90880588-90880610 GCCCTTGGAGGCTCTGTCCAGGG + Intronic
977167329 4:93715940-93715962 GGTATTGGAAGTTCTGGCCAGGG - Intronic
977264446 4:94837770-94837792 GGTGTTGGAAGTTCTGGCCAGGG - Intronic
977337076 4:95713021-95713043 AGTATTGGAAGCTCTGGCCAGGG - Intergenic
977425929 4:96866988-96867010 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
977508646 4:97934372-97934394 AGTATTTGAAGTTCTGGCCAAGG - Intronic
977515163 4:98012962-98012984 GGTATTGGAAGTTCTGGCCAGGG - Intronic
977666377 4:99650556-99650578 GGCCTTTGAGAACCTGGCCAGGG - Exonic
977946843 4:102923542-102923564 AGTCTTGGAAGTTCTGGCCAGGG + Intronic
978220997 4:106274063-106274085 GGTTTTTGAAGCTCTGGGCCAGG + Intronic
978544340 4:109854582-109854604 AGTATTGGAAGCTCTGGCCAGGG - Intronic
979017088 4:115448638-115448660 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
979044057 4:115838370-115838392 AGTATTTGAAGTTCTGGCCAGGG + Intergenic
979116741 4:116833841-116833863 TGTATTGGAAGCTCTGGCCAGGG + Intergenic
979531824 4:121776509-121776531 GGCCTTAGAATCTCTCACCAAGG - Intergenic
979732452 4:124041632-124041654 GGTATTGGAAGTTCTGGCCAGGG - Intergenic
979976429 4:127201962-127201984 GGTGTTGGAAGTTCTGGCCAAGG + Intergenic
980149773 4:129031441-129031463 AGTATTGGAAGCTCTGGCCAGGG + Intronic
980189430 4:129504494-129504516 GGCCCTTTAAGCTCTGTTCAGGG + Intergenic
980217629 4:129872754-129872776 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
980414085 4:132461878-132461900 AGTATTTGAAGTTCTGGCCAGGG + Intergenic
981415358 4:144486560-144486582 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
981440059 4:144772671-144772693 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
981630902 4:146817061-146817083 AGCGTTGGAAGTTCTGGCCAGGG + Intronic
981704493 4:147644686-147644708 GGCCGTGGAAGCTGTGCCCATGG + Intronic
982683920 4:158465189-158465211 GGTGTTGGAAGTTCTGGCCAGGG - Intronic
983101240 4:163628527-163628549 AGTATTAGAAGCTCTGGCCATGG + Intronic
983881317 4:172936404-172936426 AGTATTGGAAGCTCTGGCCAGGG + Intronic
983948459 4:173612410-173612432 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
984525762 4:180857858-180857880 TGTATTTGAAGTTCTGGCCAGGG - Intergenic
984605543 4:181781630-181781652 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
986228282 5:5837839-5837861 TGCCTTTAAAACTTTGGCCATGG + Intergenic
986419146 5:7559686-7559708 AGCATTAGAAGCTCTGGCCAGGG - Intronic
986424464 5:7616815-7616837 GGCCTTTGAAGAGGTGGCTAAGG + Intronic
986629314 5:9754387-9754409 AGTCTTGGAAGTTCTGGCCAGGG + Intergenic
986656006 5:10013044-10013066 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
987674827 5:21061934-21061956 GCCCTTGGAGGCTCTGCCCAAGG + Intergenic
987780039 5:22422089-22422111 AGTATTAGAAGCTCTGGCCATGG - Intronic
988269458 5:28995139-28995161 GGTGTTGGAAGTTCTGGCCAAGG + Intergenic
988328269 5:29799529-29799551 AGCATTGGAAGTTCTGGCCAAGG - Intergenic
988745711 5:34134933-34134955 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
988971655 5:36474454-36474476 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
989284575 5:39684528-39684550 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
989452819 5:41606742-41606764 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
989522093 5:42414324-42414346 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
990107240 5:52279531-52279553 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
990366602 5:55077363-55077385 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
990916559 5:60912603-60912625 AGCGTTGGAAGTTCTGGCCAGGG - Intronic
991323734 5:65406158-65406180 AGTGTTGGAAGCTCTGGCCAGGG - Intronic
991485118 5:67127245-67127267 AGCATTGGAAGTTCTGGCCAGGG - Intronic
991530785 5:67611715-67611737 GGCCTTTTAAGATTTGGACAGGG - Intergenic
992078263 5:73211191-73211213 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
992174057 5:74132660-74132682 GGCCTTTGGGGCTGTGGCCCTGG + Intergenic
993609926 5:90041569-90041591 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
993621810 5:90177465-90177487 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
993821232 5:92619475-92619497 GGTTTTGGAAGTTCTGGCCAGGG - Intergenic
994405599 5:99341626-99341648 AGTCTTGGAAGTTCTGGCCAGGG - Intergenic
994657531 5:102612206-102612228 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
994785078 5:104149164-104149186 AGTATTTGAAGTTCTGGCCAGGG + Intergenic
994802587 5:104397899-104397921 GGTATTGGAAGTTCTGGCCAGGG + Intergenic
994834320 5:104830020-104830042 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
995003391 5:107161915-107161937 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
995286800 5:110398512-110398534 GGCCTATGCAGATCTGTCCATGG - Intronic
995363704 5:111329357-111329379 GGTGTTGGAAGTTCTGGCCAGGG + Intronic
995664381 5:114524723-114524745 AGTGTTTGAAGTTCTGGCCAAGG + Intergenic
995796167 5:115943753-115943775 AGCTTTGGAAGCTCTGGCCAGGG - Intergenic
996501121 5:124217285-124217307 AGTCTTGGAAGTTCTGGCCAGGG + Intergenic
996789076 5:127272940-127272962 AGCATTGGAAGATCTGGCCAGGG - Intergenic
996952887 5:129149177-129149199 GGAATTGGAAGTTCTGGCCAGGG - Intergenic
997004107 5:129798706-129798728 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
997012060 5:129890423-129890445 AGCATTGGAAGCTCTGGCCAGGG - Intergenic
998976500 5:147654724-147654746 AGCATTGGAAGCTCTGGCCAGGG - Intronic
999666002 5:153914105-153914127 GGTATTGGAAGTTCTGGCCAGGG - Intergenic
999984324 5:156988549-156988571 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
1000597928 5:163236871-163236893 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1001869451 5:175138437-175138459 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1002265190 5:178025811-178025833 GGTGTTGGAAGTTCTGGCCAGGG - Intronic
1002764379 6:226690-226712 GGCCTCCGAAGCTCTGGCCTGGG + Intergenic
1003518028 6:6833917-6833939 GTCCTTGGAAGTGCTGGCCAAGG + Intergenic
1003652069 6:7970095-7970117 GGCTTTTGAAGTTCTGCCCCAGG - Intronic
1003976332 6:11347922-11347944 AGTATTGGAAGCTCTGGCCAGGG + Intronic
1004949387 6:20651566-20651588 AGCATTGGAAGTTCTGGCCAGGG - Intronic
1006000963 6:30964806-30964828 GGTCTTGGAAGCTGTGGTCATGG - Intergenic
1006846990 6:37069213-37069235 GTCCTTGGAGGCTCAGGCCAAGG - Intergenic
1007093738 6:39200727-39200749 GACATCTGAAGCTCTGGGCAAGG - Intronic
1007858524 6:44883015-44883037 AGTATTTGAAGTTCTGGCCAGGG + Intronic
1008116645 6:47558334-47558356 GGTATTGGAAGTTCTGGCCAGGG - Intronic
1008999337 6:57695642-57695664 AGCCTTTGAAGAACTGGACATGG + Intergenic
1009187828 6:60595047-60595069 AGCCTTTGAAGAACTGGACATGG + Intergenic
1009219474 6:60966197-60966219 AGTCTTGGAAGTTCTGGCCAGGG + Intergenic
1009237329 6:61138793-61138815 AGTCTTGGAAGTTCTGGCCAGGG + Intergenic
1009432864 6:63585734-63585756 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
1009453981 6:63833196-63833218 GGTGTTGGAAGTTCTGGCCAGGG + Intronic
1009455695 6:63853112-63853134 AGTATTGGAAGCTCTGGCCAGGG + Intronic
1010262959 6:73837393-73837415 AGTCTTGGAAGTTCTGGCCAGGG - Intergenic
1010321143 6:74511870-74511892 AGTCTTGGAAGTTCTGGCCAGGG + Intergenic
1010414993 6:75602287-75602309 GGCCTGAGAAGCTCGGGCCGCGG + Exonic
1010680808 6:78796671-78796693 AGCATTTGAAGTCCTGGCCAGGG - Intergenic
1010718085 6:79253310-79253332 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1011214588 6:84991757-84991779 GGCATTGGAAGTTCTGGCCAGGG + Intergenic
1011666976 6:89643738-89643760 TGCCTTGGAAGCCCTGGCCTGGG - Exonic
1012250720 6:96976933-96976955 GGCCTATGAATCTCTGTCCTTGG - Intronic
1012608960 6:101192259-101192281 AGTGTTTGAAGTTCTGGCCAGGG + Intergenic
1012679932 6:102167446-102167468 AGAATTGGAAGCTCTGGCCAGGG + Intergenic
1012685721 6:102246076-102246098 AGTATTGGAAGCTCTGGCCAGGG + Intergenic
1013439238 6:110145471-110145493 AGCGTTGGAAGTTCTGGCCAGGG - Intronic
1013787350 6:113796629-113796651 GTCCTCTGAAGGTCTGACCAGGG + Intergenic
1013930101 6:115520227-115520249 GGTATTGGAAGTTCTGGCCAAGG + Intergenic
1014154754 6:118097420-118097442 GGCCTTTAATGCTCTGGCTCAGG - Intronic
1014192823 6:118517748-118517770 AGCATTGGAAGTTCTGGCCAGGG - Intronic
1014332494 6:120087093-120087115 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
1014375495 6:120667296-120667318 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
1014485824 6:121997971-121997993 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1015882883 6:137887381-137887403 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1015902257 6:138080072-138080094 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
1016168098 6:140973191-140973213 GGTATTAGAAGTTCTGGCCAGGG + Intergenic
1016875474 6:148860507-148860529 AGTGTTGGAAGCTCTGGCCAGGG - Intronic
1017372664 6:153731665-153731687 GGTATTGGAAGTTCTGGCCAGGG + Intergenic
1019033290 6:169032158-169032180 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1020117979 7:5487075-5487097 GGCCTTTGCAGCTGCGCCCAAGG - Intronic
1020429005 7:8100253-8100275 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
1020633419 7:10668474-10668496 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
1020923752 7:14297684-14297706 AGTATTGGAAGCTCTGGCCAGGG + Intronic
1022187648 7:27986092-27986114 AGTGTTGGAAGCTCTGGCCAGGG + Intronic
1023053912 7:36276745-36276767 GTTCTTTGAGGTTCTGGCCAAGG - Intronic
1023460407 7:40390264-40390286 GGTGTTGGAAGTTCTGGCCAGGG + Intronic
1024581642 7:50805480-50805502 GTCCTTTGAAGGGCTGGGCAGGG + Intergenic
1024900184 7:54310243-54310265 AGTGTTTGAAGTTCTGGCCAGGG + Intergenic
1025158907 7:56636041-56636063 GTCCCTGGAGGCTCTGGCCAGGG - Intergenic
1026643279 7:72146101-72146123 AGCGTTGGAAGTTCTGGCCAGGG + Intronic
1026645161 7:72161102-72161124 GGCTGTTGAAGCTCCTGCCATGG - Intronic
1027542670 7:79487609-79487631 GGCTTGTGAAGCTGTGGTCAGGG + Intergenic
1027563265 7:79759353-79759375 AGCATTGGAAGCTATGGCCAGGG - Intergenic
1027863826 7:83620974-83620996 AGCATTGGAAGTTCTGGCCAGGG + Intronic
1027983343 7:85253847-85253869 AGTGTTTGAAGTTCTGGCCAGGG + Intergenic
1028027991 7:85870564-85870586 AGTATTTGAAGTTCTGGCCAAGG + Intergenic
1028080668 7:86571307-86571329 AGCATTAGAAGATCTGGCCAGGG + Intergenic
1028082921 7:86600066-86600088 GCCCCTTGAGGCTCTGTCCAGGG - Intergenic
1028512980 7:91645234-91645256 GGCCTTTGAAGGTCAGACTAAGG - Intergenic
1028544684 7:91985125-91985147 AGTCTTGGAAGTTCTGGCCAGGG - Intronic
1028633262 7:92959396-92959418 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1028723897 7:94065319-94065341 GGACTTTGAAGATGTGGCAAAGG - Intergenic
1028813880 7:95121731-95121753 GGCCTTTGCACCTTTTGCCACGG - Intronic
1029808392 7:103020454-103020476 AGCGTTGGAAGTTCTGGCCAGGG + Intronic
1029817416 7:103110708-103110730 AGCATTCGAAGTTCTGGCCAGGG + Intronic
1029875416 7:103745395-103745417 GGTGTTGGAAGTTCTGGCCAGGG + Intronic
1029880201 7:103800116-103800138 AGTGTTGGAAGCTCTGGCCAGGG + Intronic
1030256940 7:107520275-107520297 AGCATTGGAAGTTCTGGCCAGGG + Intronic
1030448182 7:109673712-109673734 GGTATTGGAAGTTCTGGCCAGGG + Intergenic
1031191216 7:118553381-118553403 GGGGTTGGAAGTTCTGGCCAGGG + Intergenic
1031627129 7:124004517-124004539 GCCCTTGGATGCTCTGTCCAGGG + Intergenic
1032280301 7:130494467-130494489 TGCCTTTGAAGTCCTGGGCATGG + Intronic
1032537319 7:132675407-132675429 AGCGTTGGAAGTTCTGGCCAGGG - Intronic
1032764713 7:134980124-134980146 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1032777199 7:135126023-135126045 AGTATTGGAAGCTCTGGCCAGGG + Intronic
1033184549 7:139215367-139215389 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1033787559 7:144752142-144752164 AGCATTGGAAGTTCTGGCCAGGG - Intronic
1034162751 7:149005046-149005068 GGCGTCTGGTGCTCTGGCCACGG - Intronic
1034318000 7:150152151-150152173 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1034518522 7:151601004-151601026 GGGATTTGAAGCTCTGTCCCAGG + Intronic
1035535272 8:386238-386260 TGCCCTTGAACCTCTGCCCAGGG + Intergenic
1035626733 8:1076531-1076553 GGGCTGTGATGCTCCGGCCAGGG + Intergenic
1036211757 8:6847095-6847117 AGGGTTGGAAGCTCTGGCCAGGG - Intergenic
1038537827 8:28366914-28366936 GGCTTTTGATGCTCTTGCTAAGG - Intronic
1038981105 8:32760669-32760691 GGAGTTTCCAGCTCTGGCCATGG + Intronic
1039924340 8:41915697-41915719 GGCCTTTGAAGCAGTGGTGAGGG - Intergenic
1040429160 8:47321073-47321095 GGTGTTGGAAGTTCTGGCCAGGG + Intronic
1040437265 8:47403334-47403356 AGCGTTGGAAGTTCTGGCCAGGG + Intronic
1040446588 8:47501655-47501677 GGTGTTGGAAGTTCTGGCCAGGG - Intronic
1040783953 8:51143430-51143452 AGTATTAGAAGCTCTGGCCAGGG - Intergenic
1040827764 8:51642671-51642693 AGCGTTGGAAGTTCTGGCCAGGG + Intronic
1040968433 8:53108491-53108513 AGTATTTGAAGTTCTGGCCAGGG - Intergenic
1041025489 8:53681605-53681627 GGTGTTGGAAGTTCTGGCCAAGG + Intergenic
1041217942 8:55619872-55619894 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1041274998 8:56148156-56148178 AGTGTTGGAAGCTCTGGCCAGGG - Intergenic
1041420692 8:57664474-57664496 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1041581441 8:59464312-59464334 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1042489938 8:69385543-69385565 GGTGTTAGAAGTTCTGGCCAGGG + Intergenic
1042981768 8:74537625-74537647 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
1043165508 8:76898093-76898115 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
1043241890 8:77944496-77944518 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1043586165 8:81772207-81772229 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1043650409 8:82584307-82584329 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1043688329 8:83116719-83116741 AGTGTTGGAAGCTCTGGCCAGGG - Intergenic
1045481645 8:102597462-102597484 CACATTTGAAGCTCTGGCCTTGG + Intergenic
1045933158 8:107650207-107650229 AGTATTGGAAGCTCTGGCCAGGG - Intergenic
1046189715 8:110777551-110777573 AGTATTTGAAGTTCTGGCCAGGG + Intergenic
1047440793 8:124876358-124876380 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
1047675256 8:127194251-127194273 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1048087667 8:131201617-131201639 AGCCATTCCAGCTCTGGCCATGG + Intergenic
1048138126 8:131766062-131766084 GTCCTTGGCAGCTGTGGCCAGGG + Intergenic
1048796751 8:138157426-138157448 GGTGTTGGAAGTTCTGGCCAAGG + Intronic
1049201162 8:141341338-141341360 GGCCCTTGAAGCTGTGTCCCTGG - Intergenic
1049276175 8:141721151-141721173 GGCCTTGGAGCCTGTGGCCATGG + Intergenic
1050033377 9:1409655-1409677 AGTGTTGGAAGCTCTGGCCAGGG - Intergenic
1050264064 9:3871610-3871632 GGGGCCTGAAGCTCTGGCCATGG - Intronic
1050398487 9:5225844-5225866 AGTATTTGAAGCCCTGGCCAGGG + Intergenic
1050505095 9:6339985-6340007 GGTGTTAGAAGTTCTGGCCAGGG + Intergenic
1050603789 9:7279696-7279718 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1050864112 9:10476113-10476135 AGTTTTTGAAGTTCTGGCCAGGG + Intronic
1051081879 9:13303512-13303534 AGTGTTGGAAGCTCTGGCCAGGG - Intergenic
1051085333 9:13342154-13342176 AGTGTTGGAAGCTCTGGCCAGGG - Intergenic
1051354308 9:16227430-16227452 GGTATTGGAAGTTCTGGCCAGGG + Intronic
1051396188 9:16624143-16624165 GCCCTTTGAATGTCTGGGCATGG + Intronic
1052158948 9:25231013-25231035 AGTATTTGAAGTTCTGGCCAGGG - Intergenic
1052330116 9:27259287-27259309 GGACTTTGAAGGTCCAGCCAAGG - Intergenic
1052408315 9:28090694-28090716 AGCGTTGGAAGTTCTGGCCAGGG + Intronic
1052410298 9:28113923-28113945 AGCGTTGGAAGTTCTGGCCAGGG - Intronic
1052604411 9:30680821-30680843 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1053088253 9:35247365-35247387 AGCGTTGGAAGTTCTGGCCAGGG - Intronic
1053637907 9:40033692-40033714 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1053768175 9:41431528-41431550 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
1054546843 9:66343032-66343054 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1055133018 9:72796852-72796874 AGTATTTGAAGTTCTGGCCAGGG + Intronic
1056247315 9:84708650-84708672 GGCCTTTGAAGATTAGGCAATGG + Intronic
1056384793 9:86087452-86087474 GGTATTTGAAGTTCTGGCCAGGG - Intronic
1056885532 9:90440113-90440135 GGTATTGGAAGTTCTGGCCAGGG - Intergenic
1058570542 9:106337570-106337592 AGTGTTTGAAGTTCTGGCCAGGG - Intergenic
1059262333 9:112990127-112990149 GGTATTGGAAGTTCTGGCCAGGG - Intergenic
1059441388 9:114309013-114309035 GATCTTTGAAGCTCTGGCTCTGG + Intronic
1060030188 9:120207981-120208003 GGTTTTTGAAGCTCAGGTCAGGG + Intergenic
1060461658 9:123861174-123861196 GGCCTTATAAGCACTGGTCAGGG - Intronic
1060584575 9:124777806-124777828 GGCCTCTGATGTTCTTGCCAGGG + Intronic
1060848065 9:126852966-126852988 GGCCAGTGAAGCTCTGGGCCAGG + Intergenic
1061245394 9:129398937-129398959 GTCCTTTGATGCTATAGCCAGGG + Intergenic
1061280494 9:129595362-129595384 GGACTTCGAGGCTGTGGCCAGGG - Intergenic
1062348938 9:136129419-136129441 GGCCTTAGAAGCTCTGGGAACGG - Intergenic
1062373092 9:136250223-136250245 GTCCTTGGAAGCCCTGGCCCGGG + Intergenic
1203532398 Un_GL000213v1:158665-158687 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
1203688550 Un_GL000214v1:20034-20056 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1203354302 Un_KI270442v1:117582-117604 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1203355242 Un_KI270442v1:131808-131830 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1203647725 Un_KI270751v1:84019-84041 AGTGTTGGAAGCTCTGGCCAGGG - Intergenic
1190126884 X:47713577-47713599 AGTATTGGAAGCTCTGGCCAGGG + Intergenic
1190821030 X:53972776-53972798 AGCATTGGAAGTTCTGGCCATGG + Intronic
1190943565 X:55069050-55069072 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
1191051547 X:56198217-56198239 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1191125620 X:56950748-56950770 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1191646070 X:63482447-63482469 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1191685092 X:63881488-63881510 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1191948476 X:66562090-66562112 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
1192263493 X:69523367-69523389 GGCGCTTGCAGCCCTGGCCAGGG - Intronic
1192392875 X:70749433-70749455 GGTGTTGGAAGTTCTGGCCAGGG - Intronic
1192969176 X:76213298-76213320 AGTGTTTGAAGTTCTGGCCAGGG + Intergenic
1192984641 X:76383810-76383832 AGTCTTGGAAGTTCTGGCCAGGG + Intergenic
1193060705 X:77204004-77204026 AGTATTGGAAGCTCTGGCCAGGG - Intergenic
1193306726 X:79959640-79959662 GGCCTTGGAGGCTCTGGAAAAGG + Intergenic
1193318740 X:80095605-80095627 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1193324768 X:80167227-80167249 GGTATTGGAAGTTCTGGCCAGGG - Intergenic
1193475787 X:81963976-81963998 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
1193477610 X:81985721-81985743 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1193728958 X:85079102-85079124 GGTGTTGGAAGTTCTGGCCAGGG - Intronic
1193789127 X:85797340-85797362 GCCCCTGGAAGCTCTGTCCAGGG + Intergenic
1194025864 X:88750084-88750106 AGCATTGGAAGTTCTGGCCAGGG - Intronic
1194055599 X:89127856-89127878 GCCCCTGGAAGCTCTGACCAGGG + Intergenic
1194248416 X:91542761-91542783 GGTATTAGAAGTTCTGGCCAGGG + Intergenic
1194342268 X:92719642-92719664 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1194516928 X:94866365-94866387 AGTGTTTGAAGTTCTGGCCAGGG + Intergenic
1194622323 X:96188630-96188652 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1194635270 X:96338774-96338796 AGAATTTGAAGTTCTGGCCAGGG - Intergenic
1194636184 X:96347377-96347399 AGTCTTGGAAGTTCTGGCCAGGG - Intergenic
1194735809 X:97511520-97511542 AGTCTTGGAAGTTCTGGCCAGGG - Intronic
1195162888 X:102188191-102188213 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1195436395 X:104848205-104848227 AGCGTTGGAAGTTCTGGCCAGGG - Intronic
1195548243 X:106137754-106137776 GGCCTCTGAAATTCTGGCAAGGG + Intergenic
1195579841 X:106489138-106489160 AGTATTGGAAGCTCTGGCCAGGG - Intergenic
1195614194 X:106899999-106900021 GGTCTCTGAACCTCTGCCCATGG + Intronic
1195622423 X:106970451-106970473 GGTATTGGAAGTTCTGGCCAGGG + Intronic
1195854602 X:109316883-109316905 GGTATTGGAAGTTCTGGCCAGGG - Intergenic
1195932497 X:110092721-110092743 AGTGTTGGAAGCTCTGGCCAGGG - Intronic
1196139222 X:112242707-112242729 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1196183675 X:112722604-112722626 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
1196562556 X:117167955-117167977 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
1196658608 X:118245835-118245857 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
1197087343 X:122494477-122494499 AGCATTGGAAGTTCTGGCCAAGG - Intergenic
1197239310 X:124106414-124106436 AGCGTTGGAAGTTCTGGCCAGGG - Intronic
1197357109 X:125448653-125448675 GGGATTGGAAGTTCTGGCCAGGG + Intergenic
1197594077 X:128445801-128445823 AGCATTGGAAGTTCTGGCCAGGG - Intergenic
1197959989 X:131993623-131993645 AGCATTGGAAGTTCTGGCCAGGG + Intergenic
1198646200 X:138809575-138809597 AGTGTTTGAAGTTCTGGCCAGGG + Intronic
1198922580 X:141746813-141746835 AGCCTTGGAAGTTCTGGCCAGGG - Intergenic
1198981745 X:142405495-142405517 GGTATTAGAAGTTCTGGCCAGGG + Intergenic
1199468714 X:148169803-148169825 AGTGTTGGAAGCTCTGGCCAGGG + Intergenic
1199481358 X:148301758-148301780 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1199486002 X:148348917-148348939 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1199674131 X:150170914-150170936 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1199812919 X:151368860-151368882 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic
1200333602 X:155323661-155323683 AGCATTGGAAGTTCTGGCCAGGG + Intronic
1200567427 Y:4784281-4784303 GGTATTAGAAGTTCTGGCCAGGG + Intergenic
1200650625 Y:5836337-5836359 AGTGTTGGAAGCTCTGGCCACGG + Intergenic
1200883265 Y:8242637-8242659 AGCGTTGGAAGTTCTGGCCAAGG - Intergenic
1201182520 Y:11362919-11362941 AGTCTTGGAAGTTCTGGCCAGGG + Intergenic
1201780194 Y:17712472-17712494 AGCGTTGGAAGTTCTGGCCAGGG + Intergenic
1201821361 Y:18193520-18193542 AGCGTTGGAAGTTCTGGCCAGGG - Intergenic
1201862600 Y:18615749-18615771 GGGCATTGAATTTCTGGCCAGGG + Intergenic
1201870723 Y:18704631-18704653 GGGCATTGAATTTCTGGCCAGGG - Intergenic
1201930531 Y:19340268-19340290 GACATTGGAAGTTCTGGCCAGGG - Intergenic
1202045634 Y:20734995-20735017 AGCCTTTGAAGCTCTGGATTTGG - Intergenic
1202068518 Y:20966161-20966183 AGTGTTGGAAGCTCTGGCCATGG + Intergenic
1202115755 Y:21467902-21467924 GGCCTTTGGAACTGTGGGCATGG - Intergenic
1202248918 Y:22849248-22849270 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1202401907 Y:24482996-24483018 GGTGTTGGAAGTTCTGGCCAGGG - Intergenic
1202468875 Y:25187087-25187109 GGTGTTGGAAGTTCTGGCCAGGG + Intergenic