ID: 1084872730

View in Genome Browser
Species Human (GRCh38)
Location 11:72108967-72108989
Sequence TTTTGAGGTCCCTGCTTGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 131}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084872730_1084872749 30 Left 1084872730 11:72108967-72108989 CCACCCAAGCAGGGACCTCAAAA 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1084872749 11:72109020-72109042 ACACGCTGGGCTCAGGGCTAGGG 0: 1
1: 0
2: 1
3: 12
4: 179
1084872730_1084872746 23 Left 1084872730 11:72108967-72108989 CCACCCAAGCAGGGACCTCAAAA 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1084872746 11:72109013-72109035 CCTTGACACACGCTGGGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 141
1084872730_1084872734 -2 Left 1084872730 11:72108967-72108989 CCACCCAAGCAGGGACCTCAAAA 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1084872734 11:72108988-72109010 AATCCCCTCCCTTTCCTGTTTGG 0: 1
1: 1
2: 0
3: 16
4: 214
1084872730_1084872743 16 Left 1084872730 11:72108967-72108989 CCACCCAAGCAGGGACCTCAAAA 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1084872743 11:72109006-72109028 TTTGGGGCCTTGACACACGCTGG 0: 1
1: 0
2: 0
3: 1
4: 69
1084872730_1084872747 24 Left 1084872730 11:72108967-72108989 CCACCCAAGCAGGGACCTCAAAA 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1084872747 11:72109014-72109036 CTTGACACACGCTGGGCTCAGGG 0: 1
1: 0
2: 0
3: 14
4: 114
1084872730_1084872748 29 Left 1084872730 11:72108967-72108989 CCACCCAAGCAGGGACCTCAAAA 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1084872748 11:72109019-72109041 CACACGCTGGGCTCAGGGCTAGG 0: 1
1: 1
2: 3
3: 34
4: 329
1084872730_1084872744 17 Left 1084872730 11:72108967-72108989 CCACCCAAGCAGGGACCTCAAAA 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1084872744 11:72109007-72109029 TTGGGGCCTTGACACACGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 60
1084872730_1084872735 -1 Left 1084872730 11:72108967-72108989 CCACCCAAGCAGGGACCTCAAAA 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1084872735 11:72108989-72109011 ATCCCCTCCCTTTCCTGTTTGGG 0: 1
1: 0
2: 1
3: 26
4: 309
1084872730_1084872736 0 Left 1084872730 11:72108967-72108989 CCACCCAAGCAGGGACCTCAAAA 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1084872736 11:72108990-72109012 TCCCCTCCCTTTCCTGTTTGGGG 0: 1
1: 0
2: 3
3: 44
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084872730 Original CRISPR TTTTGAGGTCCCTGCTTGGG TGG (reversed) Exonic
902702232 1:18180280-18180302 TTTTGAGCACCCTGCATGGCAGG - Intronic
904258423 1:29272314-29272336 TTGGGTGGTCCCTGCTTGTGGGG + Intronic
905280222 1:36844311-36844333 TGTTGAGCTGCCTGCTTGGTTGG - Intronic
906019208 1:42612491-42612513 TTTTGGGCTCCCTGGTTGTGAGG - Intronic
907426332 1:54381656-54381678 CTTTGTGGTCCCAGCGTGGGTGG - Intronic
908724408 1:67159634-67159656 GCTTGTGGTCCCTACTTGGGAGG + Intronic
911890152 1:103358474-103358496 TTTTGTGGTCTCTGCTTTAGAGG - Intergenic
915449507 1:155994823-155994845 TTTGGAGGCCACTGGTTGGGAGG - Intronic
922590566 1:226772713-226772735 TTATGATGTCCCTGCTATGGGGG - Intergenic
923814377 1:237358984-237359006 CTTTGACATCCCTGCTTAGGTGG + Intronic
1064052383 10:12069396-12069418 CTTTGAGGTCCACGCTTGGGTGG + Intronic
1064983020 10:21183110-21183132 TGGTGGTGTCCCTGCTTGGGGGG - Intergenic
1065749983 10:28876936-28876958 TTTTAAGCTCCCTCCTTGGGAGG - Intronic
1066276520 10:33874047-33874069 TTTTCAGTGCCCTGCTTGGCAGG + Intergenic
1067296390 10:44977430-44977452 TTCTGAGGACACTGCTGGGGCGG + Exonic
1069864037 10:71490004-71490026 CTTTGGGGTGCCTGCTTGAGGGG + Intronic
1070802052 10:79249530-79249552 TCTTGAGGTCCCTGCTTGTAAGG + Intronic
1073759126 10:106611727-106611749 CTTTGAGGTCTCTGCATGTGTGG + Intronic
1076345218 10:129774773-129774795 CTGTGAGCTTCCTGCTTGGGTGG - Intergenic
1076418607 10:130311144-130311166 TTTGGAGCTCCCTGCTTCTGAGG - Intergenic
1079383461 11:19958820-19958842 TTATGAGGTTGGTGCTTGGGTGG + Intronic
1081887146 11:46507642-46507664 TTTTAAGGTTCCTGAATGGGGGG + Intronic
1083656129 11:64230590-64230612 TCTTGGGGTCCCTGGCTGGGTGG + Exonic
1084872730 11:72108967-72108989 TTTTGAGGTCCCTGCTTGGGTGG - Exonic
1093994470 12:25626796-25626818 TTTTGAGGTTTCAGCTTGGGTGG - Intronic
1096111480 12:49031670-49031692 TTTGGGGGTCCCTGGATGGGTGG + Exonic
1101788550 12:107908207-107908229 TTTTGTGCTCCCTGCCTGAGTGG + Intergenic
1102248197 12:111368478-111368500 CTCTGGGGTCCCTGCTGGGGCGG - Intronic
1105069616 12:133226712-133226734 TTTTGAGGTCACTGTGTGGCCGG - Intronic
1107464806 13:40639708-40639730 TTTTGTTGTCACAGCTTGGGTGG - Intronic
1107953884 13:45490290-45490312 TTTTGGGGTCCCCACCTGGGAGG + Intronic
1107967905 13:45614087-45614109 TATTGAGGTCTCTGGTTGGAAGG - Intronic
1109903564 13:68807689-68807711 TATTGAGGTGCCTTCTTGGCAGG - Intergenic
1110431581 13:75430431-75430453 TTTTGAAGTACGTGCTTGGGTGG - Intronic
1114331102 14:21637882-21637904 TTCTGGGTTCCCTGCCTGGGAGG + Intergenic
1120968767 14:90190541-90190563 ATTTGAGGTCAGTGCTTAGGGGG + Intergenic
1125084418 15:35713785-35713807 TTATGAGGTCCCAGCTAGAGAGG + Intergenic
1125887351 15:43238674-43238696 TTTTGAGGCCCCAGTTGGGGTGG - Intronic
1126775878 15:52100318-52100340 TTTTGAGGTCTCTCTTTGGAGGG + Intergenic
1132834269 16:1944883-1944905 TTTTGGGGGCCCTGGTTGAGAGG + Exonic
1133540541 16:6748539-6748561 ATTTGTAGTCCCAGCTTGGGAGG + Intronic
1136597555 16:31262011-31262033 TTGTGAGGTCCCTCCTGGGAAGG - Intronic
1139441958 16:66972842-66972864 TATTGGGGTCCCTGGGTGGGAGG - Exonic
1142354516 16:89596265-89596287 TTTTCATCTCCGTGCTTGGGGGG + Intronic
1143447804 17:7019296-7019318 TTTGGAGGTGCGTGCTGGGGTGG - Intergenic
1144293250 17:13846923-13846945 TTTTCAAGTCCTTGCTTGGTTGG + Intergenic
1144415484 17:15042388-15042410 TTCTGAGCTCCCTGCGTGGAAGG - Intergenic
1146461887 17:33052631-33052653 GTATGAGGTCCCTGCTTGTTGGG + Intronic
1146612784 17:34322406-34322428 TTTTGTGGACCCTGCCTGGGAGG - Intergenic
1147266288 17:39236826-39236848 TTCTGAGGGGCCTGCCTGGGGGG - Intergenic
1147992836 17:44345557-44345579 TGGTGTGGTCCCTGCTTTGGGGG - Intronic
1150480211 17:65503504-65503526 TTTTTAGGACCCTGCTTTGTAGG - Intergenic
1151930835 17:77230443-77230465 TTCAGAGGTGCCTGCCTGGGAGG + Intergenic
1155312397 18:24536646-24536668 TGTTGAGGTCCCTCCTTAGGAGG + Intergenic
1158104388 18:53869190-53869212 TTTTGAGTTCCTTGTTTTGGAGG - Intergenic
1158471630 18:57742350-57742372 TTTTTAGGTCCTGCCTTGGGAGG - Intronic
1161919794 19:7257508-7257530 TTTGGAGCTCTCTGTTTGGGTGG - Intronic
1162733293 19:12731692-12731714 TCTTGTGGTCCCTGCTAGGGAGG - Intronic
1162808568 19:13151380-13151402 TTTTGAGTTCCCAGCGTGCGGGG + Intronic
926792660 2:16590754-16590776 TCTAGAGGTCCTTGCTTGAGAGG - Intronic
929811316 2:45191285-45191307 TTTTGTGGTCCCTGGCTGGCAGG - Intergenic
934494827 2:94788018-94788040 TTTTGAGGTCCCTGGAGGGAAGG - Intergenic
934711656 2:96519183-96519205 TTTTAAGATCTTTGCTTGGGAGG + Intergenic
937282087 2:120725056-120725078 TTCACAGGTCCCTGTTTGGGGGG + Intergenic
937574310 2:123400446-123400468 TTTGGTGGTCCTTGCTTGGCTGG + Intergenic
938955251 2:136291465-136291487 CTTTGAGATCCCTGCTGGTGAGG - Intergenic
942505229 2:176634821-176634843 GTTTGACCTCCCTGCTTGGAAGG - Intergenic
942939383 2:181598458-181598480 CTTTGGGGTCGCTGGTTGGGGGG - Intronic
943319000 2:186423971-186423993 CTTTGAGATCCCTGCATGTGGGG - Intergenic
944826915 2:203493375-203493397 TTTTATTGTCCATGCTTGGGAGG - Intronic
945274933 2:207978625-207978647 TTTTTAGGTCTCTGCTTAGATGG + Intronic
946140649 2:217687905-217687927 TTTAGAGATCCCTTCTTGGTGGG - Intronic
948479400 2:238240523-238240545 GTTTCAGGTCCCGGCTGGGGTGG + Intronic
1174289308 20:49496443-49496465 TTTTGGGCTCCCTCCCTGGGAGG + Intergenic
1178163354 21:29944101-29944123 TTTTGTTGTCCCACCTTGGGAGG - Intergenic
1182435368 22:30326557-30326579 ATTAGTGGTCCCTGCCTGGGAGG + Intronic
952043217 3:29285213-29285235 TTTTGAGGTACTTGCCGGGGTGG + Intronic
953750457 3:45604647-45604669 TGTTGAGGTCCTTGCCTTGGTGG + Intronic
954889654 3:53913461-53913483 TATGAAGGGCCCTGCTTGGGAGG - Intergenic
957266874 3:77978196-77978218 TTTTAGGGTCACTGCTTAGGAGG + Intergenic
960618971 3:119621228-119621250 TGTTAAGGTCCCTGCTGAGGGGG + Intronic
961661473 3:128470856-128470878 TTGGGAGTTCCCTGCGTGGGAGG - Intergenic
961872468 3:129998784-129998806 TTGTGAGGTCTCAGCCTGGGTGG + Intergenic
966108912 3:176373042-176373064 TTTTGATGCCCCTGCTTTTGAGG - Intergenic
966872890 3:184303178-184303200 TTTTCAGGTCACTGCTTGGGGGG + Intronic
967727217 3:192873016-192873038 TTTTGAGTTGCTTGCTTGGTGGG - Intronic
977853091 4:101854133-101854155 TTTCCAGTTCCCTTCTTGGGGGG + Intronic
983394584 4:167177404-167177426 CTTTGTGGTCCTTGCTTGGAAGG - Intronic
983415201 4:167443488-167443510 TTCTGAGGTCCCTACTTTTGAGG + Intergenic
988150566 5:27373084-27373106 TTTTGTTGTCCCAGCCTGGGTGG + Intergenic
989154391 5:38330317-38330339 TTTTGATGGCCTTGCTTGGCTGG - Intronic
989268323 5:39503316-39503338 CTGTGGGCTCCCTGCTTGGGAGG + Intergenic
990507149 5:56456065-56456087 CTTCTAGGTGCCTGCTTGGGTGG + Intergenic
994865919 5:105269531-105269553 TATTGAGGTCATTGGTTGGGAGG - Intergenic
997236011 5:132272256-132272278 TCTTAAGGTCCCTGCTCGGCCGG + Exonic
998076436 5:139240458-139240480 TTATTAGGTCCCTGGTGGGGAGG + Intronic
999151180 5:149427252-149427274 TTTTCTGGGCCCGGCTTGGGTGG - Intergenic
1000581742 5:163042062-163042084 TATTGAATTCCCTGCTTGAGAGG - Intergenic
1000618949 5:163460793-163460815 CTTTCAGCTCCCTTCTTGGGAGG + Intronic
1001176934 5:169478623-169478645 TTTTGAGGTCCCTTTTGGAGTGG + Intergenic
1001273893 5:170336408-170336430 TTTTGAGGACCCAGCGTAGGAGG + Intergenic
1001283135 5:170402440-170402462 TATGGATGTTCCTGCTTGGGAGG + Intronic
1001773462 5:174312191-174312213 TTTTGCGGTCCCGGCTTCTGCGG + Intergenic
1005130616 6:22503405-22503427 TTTTGAGGATGCTGCCTGGGAGG + Intergenic
1006365883 6:33614960-33614982 TTTAGGGGTCTCTGCGTGGGAGG - Intergenic
1007726307 6:43917939-43917961 TTTTGAGGGCTTGGCTTGGGTGG + Intergenic
1008887838 6:56450429-56450451 TTTTGAGGGCCCTGCTCATGAGG + Intergenic
1010081129 6:71864351-71864373 TTTTGTTGTCTCTGCTTGTGAGG + Intergenic
1012918354 6:105195410-105195432 GCTTGTGGTCCCTACTTGGGAGG + Intergenic
1015506143 6:133990975-133990997 TTTTGAGGTTCCTTCTGGGGAGG + Exonic
1015790261 6:136958269-136958291 TTTTGAGTTGCCGGCTTTGGTGG - Intergenic
1016444964 6:144121954-144121976 TTTTGTTGCCCCTGCTTTGGAGG + Intergenic
1022403441 7:30063840-30063862 CTTTGAGGCCCCTGCTTTGAAGG + Intronic
1022613047 7:31896221-31896243 TTTGGAGGTCCCTGCTGGAAGGG + Intronic
1024412155 7:49056707-49056729 TTTTGTGGTCCATGCTTTTGAGG + Intergenic
1024526961 7:50357215-50357237 GTGAGAGGTCCCTGCTTGTGGGG - Intronic
1034781293 7:153885095-153885117 TTTGGAGGCCCATGCTTGGTGGG + Intergenic
1034848588 7:154471619-154471641 TTGAGAGGCCCCTGGTTGGGTGG - Intronic
1042631859 8:70826233-70826255 TTTTGCGGTCCACACTTGGGAGG - Intergenic
1044250936 8:90003077-90003099 TTTTGAGGTTCAGGGTTGGGAGG + Intronic
1045487337 8:102642008-102642030 TGTTGTGGTCCCTGTTAGGGAGG - Intergenic
1045846136 8:106638585-106638607 TTTTGACATCCCTGGGTGGGTGG - Intronic
1049334123 8:142073440-142073462 TTTTGAGGCCCTTCCTTTGGAGG - Intergenic
1052257138 9:26471053-26471075 TTGTGAGGTGCATGGTTGGGGGG - Intergenic
1053105151 9:35402720-35402742 CCTAGAGGTCCCTGCTTGGGAGG - Intronic
1053662289 9:40292341-40292363 TTTTGAGGTCCCTGGAGGGAAGG + Intronic
1053912740 9:42922508-42922530 TTTTGAGGTCCCTGGAGGGAAGG + Intergenic
1054374417 9:64438570-64438592 TTTTGAGGTCCCTGGAGGGAAGG + Intergenic
1054522321 9:66083943-66083965 TTTTGAGGTCCCTGGAGGGAAGG - Intergenic
1058137153 9:101319452-101319474 TTTTGAGGGCGGGGCTTGGGGGG + Intronic
1058484872 9:105433690-105433712 TTTTCAGTTTCCTGCTTGGTGGG - Intronic
1058704629 9:107628096-107628118 CTTTGAGGGCCCTGCTTCTGGGG + Intergenic
1059464683 9:114460509-114460531 TTTTGTGGTCCATTCTTTGGTGG + Intronic
1059648008 9:116286415-116286437 TTTTGAATTCTCTGCCTGGGGGG - Intronic
1060054791 9:120404040-120404062 TTTTGGTGTCACTGCCTGGGAGG + Exonic
1060719958 9:125970106-125970128 GTATGAGGTCCCGTCTTGGGGGG + Intergenic
1061990747 9:134157360-134157382 TTCTGACCTCCCTGCTTGGGTGG + Intronic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1186498479 X:10031828-10031850 TTTTGCTGTCCCCACTTGGGGGG + Intronic
1186660307 X:11662932-11662954 TCTTGAGTTCCCTGGTTTGGAGG + Intronic
1191652202 X:63551562-63551584 TTTTGAGGTAAATGCTTGTGAGG + Intergenic
1193274512 X:79570277-79570299 TTTCTAGGGCCCTGGTTGGGAGG + Intergenic
1200341846 X:155405716-155405738 TTTTGAAGTCCTTGTCTGGGAGG - Intergenic
1200909781 Y:8521022-8521044 TTTAGAGGTCCTTGCTTTGAAGG - Intergenic