ID: 1084872967

View in Genome Browser
Species Human (GRCh38)
Location 11:72110025-72110047
Sequence CTTGCTCCTGACCCAGTTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084872967_1084872971 -7 Left 1084872967 11:72110025-72110047 CCATCAACTGGGTCAGGAGCAAG 0: 1
1: 0
2: 0
3: 8
4: 169
Right 1084872971 11:72110041-72110063 GAGCAAGGGTCCAGGAACAGAGG 0: 1
1: 0
2: 1
3: 52
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084872967 Original CRISPR CTTGCTCCTGACCCAGTTGA TGG (reversed) Exonic
901980933 1:13033486-13033508 CTGGCTCATGACCCAGTCAAGGG - Intronic
902001154 1:13195444-13195466 CTGGCTCATGACCCAGTCAAGGG + Intergenic
902020387 1:13341148-13341170 CTGGCTCATGACCCAGTCAAGGG + Intergenic
902489493 1:16770978-16771000 CTTGCACCAGACCCAAGTGAGGG + Intronic
903349411 1:22709330-22709352 CTGGCTCTTGACCCTGGTGAGGG + Intergenic
906141351 1:43535606-43535628 CTTGCTCCTGACCCACTGCCGGG + Intronic
908021253 1:59901076-59901098 CATGATCCTGACCAATTTGACGG - Exonic
910464163 1:87478623-87478645 CTTGCTCCTAACTTAGATGAGGG + Intergenic
914977441 1:152379263-152379285 CTATCTCCTGATTCAGTTGAGGG - Intergenic
915034390 1:152910190-152910212 CTAGCTCTTGATCCAGTTGCTGG - Exonic
915064148 1:153210752-153210774 CTTGCTGCTGCCCGAGGTGAGGG - Intergenic
915699207 1:157774749-157774771 CTTGCTCCTGAGCAAGTTCCAGG + Intronic
920244125 1:204575377-204575399 CCTGTGCCTGACCCAATTGAAGG - Intergenic
920389437 1:205589936-205589958 CTTGTTGCTGACCCAGGTGTGGG + Intronic
920775417 1:208932180-208932202 TCTGCTCCTGAGGCAGTTGATGG - Intergenic
922749170 1:228062729-228062751 CTTGCTCCTGACCTTTGTGACGG + Intergenic
923231320 1:231989109-231989131 CTTTCTCCTTCCCCAGTTTAGGG + Intronic
923530943 1:234811547-234811569 CTTGCACCAGACCCAAGTGAGGG - Intergenic
1067208332 10:44238491-44238513 GGTGCTCCTGGGCCAGTTGAAGG + Intergenic
1068773682 10:60849475-60849497 CACCCTCCTGGCCCAGTTGAGGG + Intergenic
1069458593 10:68573473-68573495 CCTGGTGCTGACCCAGTTCATGG + Exonic
1069819623 10:71219344-71219366 CTTGCTCCTCAGCCAGCAGAAGG - Intronic
1070559238 10:77553447-77553469 CTCACTGCTGACCCAGTGGAGGG - Intronic
1071569697 10:86690241-86690263 CTGGCTCCTGACCCACTGGGAGG - Intronic
1073480604 10:103784070-103784092 CCAGCTGCTGACCCAGGTGATGG + Intronic
1074246513 10:111699137-111699159 CTTGCCCCTGACCCAGCATAAGG + Intergenic
1077440319 11:2565868-2565890 CTTCCTCCAGACCCAGTGAAGGG - Intronic
1081738546 11:45422223-45422245 TTTCCTCCTGCCTCAGTTGATGG + Intergenic
1081760821 11:45575445-45575467 CCTGCCCCTGCCCCAGATGAAGG + Intergenic
1082806601 11:57455693-57455715 CCTGCTCCTGAGCCAGTCAATGG - Intergenic
1083579977 11:63818637-63818659 CTGGACCCTGACCCAGGTGAAGG + Exonic
1084872967 11:72110025-72110047 CTTGCTCCTGACCCAGTTGATGG - Exonic
1088909292 11:114178803-114178825 TTTCCTCCTGACCCAGTCCAGGG + Intronic
1091051308 11:132375354-132375376 CTTGCTCCTAAGCCTGCTGATGG + Intergenic
1092159602 12:6308933-6308955 CCTGCTCCTGGCCCAGCTGGTGG - Intergenic
1093806294 12:23436723-23436745 CTTTCTCCTGTCACACTTGATGG - Intergenic
1096024612 12:48350495-48350517 CTTGCTCATGCCCCAGCTCATGG - Exonic
1096374825 12:51100219-51100241 CTTGAACCTGACCCATTAGACGG - Intronic
1096800609 12:54108008-54108030 CTTGCTCCAGGCCCAGTGCAAGG + Intergenic
1098361277 12:69656769-69656791 CTTGCTCCTAATCCCTTTGATGG + Intronic
1100867880 12:98876496-98876518 CTTGCTCCTGTCCCACGTTATGG + Intronic
1102472494 12:113167613-113167635 CAGGCTCCTGACCCAGTGCAGGG - Intronic
1103848331 12:123914956-123914978 TTTTCTCTTGATCCAGTTGAGGG - Exonic
1104892592 12:132147674-132147696 CCTGCTCCTGTCCCAGTTCCGGG + Exonic
1111468511 13:88647068-88647090 CTATCTCCTGACTTAGTTGAAGG + Intergenic
1112225544 13:97536125-97536147 CTTGCTCCTCAGCCTGTAGATGG - Intergenic
1113484460 13:110644031-110644053 TTTTTTCCTGACCCATTTGAGGG - Intronic
1113554555 13:111221870-111221892 CTTGCTCCTCAGCCTGTAGATGG - Intronic
1115247296 14:31309050-31309072 GTTGTTGCTGACCCAGATGAAGG - Exonic
1117774972 14:59174433-59174455 CATGCTCATCACCCATTTGATGG - Intergenic
1122814590 14:104306289-104306311 CTTGCTCCTGAAACAGAAGAGGG + Intergenic
1122937167 14:104965627-104965649 CCTGCCCCAGACCCAGTTGCTGG + Intronic
1124898921 15:33804410-33804432 CTTGCCCCTGGCCCAGCTGTTGG + Intronic
1127145618 15:56019957-56019979 CTTGCACCTGCCCTAGATGAGGG - Intergenic
1128256286 15:66199480-66199502 CAGGGTCCTGGCCCAGTTGATGG - Intronic
1131642039 15:94303238-94303260 CTTGCTCCTCAGCCTGTAGATGG - Intronic
1131901819 15:97095808-97095830 CTTGCTCCTGAACCCGCAGACGG + Intergenic
1132675542 16:1119851-1119873 CTCGCTCCTGACCAAGCAGAGGG + Intergenic
1134668596 16:16037959-16037981 CATGTCCATGACCCAGTTGAAGG + Intronic
1135418974 16:22291703-22291725 CTTTCTACTCACTCAGTTGATGG - Intergenic
1136082804 16:27863733-27863755 CTTTCTCCTGGCCCAGTATAAGG - Intronic
1136142731 16:28297885-28297907 CTTGCCCCTGCCCCAGGTGTGGG + Intronic
1138883198 16:61041819-61041841 CTTGCTCCTCAGCCTGCTGAGGG + Intergenic
1139313966 16:66051740-66051762 CTTGCTCCTCAGCCTGCTGAGGG - Intergenic
1139447003 16:67004140-67004162 GGTGCTCCTGACCCAGGGGAAGG + Exonic
1140209308 16:72958510-72958532 CGTGCTCCAGACCCTGTCGAGGG - Exonic
1140232092 16:73125708-73125730 CTTGCTCCTCAGCCTGTAGATGG + Intergenic
1142485864 17:247339-247361 CCTGCTCCTTGCCCAGATGACGG + Intronic
1143110960 17:4552515-4552537 CTTCCTCCTGGCCCAGCAGAAGG - Exonic
1144714945 17:17427369-17427391 CTAGCTCCTGATTCAGTCGAGGG + Intergenic
1145036520 17:19544581-19544603 TTTGCTGCTGACCCTGGTGAAGG + Intronic
1150210060 17:63436906-63436928 CTTGCTCCTGCCCCAGGGGGAGG + Intronic
1153822070 18:8840548-8840570 GGGGCTCCTGACCTAGTTGAGGG + Intergenic
1156001023 18:32384140-32384162 CTAGCGACTGACCCAGTTGATGG - Intronic
1157101359 18:44733070-44733092 CTAGCTCCAGACCTAGATGAGGG + Intronic
1159022047 18:63151372-63151394 CTTGCTCCTGACCTCATAGAAGG - Intronic
1159819468 18:73121548-73121570 CTTGCTCCTCAGCCTGTAGATGG - Intergenic
1160006158 18:75070484-75070506 TGTGCTCCTGCCGCAGTTGAAGG + Intergenic
1160806741 19:995266-995288 CCTGCTCCTGACCCATCTGACGG - Intronic
1162184464 19:8894270-8894292 CTTGCTCCTTTCACTGTTGAGGG - Intronic
1162998522 19:14351414-14351436 CTTCCTCCTAACCCCCTTGATGG + Intergenic
1163071912 19:14850232-14850254 CTCACTCCTGACCCATTTTATGG + Intergenic
1163181062 19:15602400-15602422 CATGTTCTTGATCCAGTTGATGG + Intergenic
1163755923 19:19106111-19106133 CTTCCTCCTGGCCAAGCTGATGG - Intronic
1164325942 19:24191840-24191862 CTCCCTCCTTACCCAGTTGTGGG - Intergenic
1165925839 19:39325941-39325963 CTGGCTCCAGACTCAGTTCAGGG + Intergenic
925375524 2:3381468-3381490 CTTTCTCCTTGTCCAGTTGAGGG - Intronic
925722750 2:6844390-6844412 CTATCTCCTGATTCAGTTGACGG - Intronic
928935240 2:36669491-36669513 CTGTCTCCTGACCCATCTGAGGG + Intergenic
932075746 2:68660814-68660836 CTTGCCCCTGACTCAGAGGATGG - Intergenic
932431662 2:71679245-71679267 CTTCCTCCAGCCCCAGTGGAGGG + Intronic
933669217 2:84990923-84990945 CTTGCTCAAAACCCAGTGGATGG + Intronic
935314347 2:101816758-101816780 GGTGCCACTGACCCAGTTGAAGG + Intronic
937452418 2:122012482-122012504 CCAGCTCCTGAGCCTGTTGATGG - Intergenic
941894299 2:170613882-170613904 CTTGCTCCTCAGCCTGTAGATGG + Intronic
943551080 2:189340107-189340129 CTTGCCCCTTACCCTGCTGATGG - Intergenic
945967335 2:216202626-216202648 CTTGCACATGGCCCAGTTTAGGG + Intronic
946598699 2:221335324-221335346 GTTGCTGCTGACCCTGCTGATGG - Intergenic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
948667055 2:239542710-239542732 CTTGTTCCTAACCCACTCGAAGG + Intergenic
948912211 2:241010391-241010413 CTTCCTCCTGAGCCAGCAGAGGG + Intronic
1171795847 20:29566348-29566370 CTTGCTCCAGGCCCAGTGCAAGG - Intergenic
1171852388 20:30317809-30317831 CTTGCTCCAGGCCCAGTGCAAGG + Intergenic
1172463018 20:35134440-35134462 CATGCCCCTGACTCACTTGACGG - Intronic
1173016709 20:39232502-39232524 CTTGCTCTTTAGCAAGTTGAAGG + Intergenic
1176688800 21:9880188-9880210 CTTGCTCCCTCCCCAGTTGGAGG + Intergenic
1177124663 21:17181506-17181528 CTATCTCCTGATTCAGTTGAGGG + Intergenic
1180737327 22:18027108-18027130 CTTGATACTGACCCTGCTGATGG + Intergenic
1181364156 22:22361853-22361875 CTTGCTCCTCACCCTGCAGATGG - Intergenic
1181766937 22:25098917-25098939 CTTTCTCCTGACCCAGCTGGAGG - Intronic
1182527741 22:30932027-30932049 CTTTCTTCTGCCCCAGTAGAGGG - Intronic
1184602942 22:45554265-45554287 CATGCTCCTCCCCCAGTTCACGG + Intronic
1184821081 22:46909694-46909716 CCTGCTCCTGACCCTTTTGGGGG + Intronic
1185115106 22:48929474-48929496 CTTGCTCCTGGCCCTGCTGCAGG + Intergenic
949100742 3:141928-141950 CTTTCTCCTGAACCATTTGAGGG + Intergenic
950458145 3:13104777-13104799 CTGGCCCCTGACCCATGTGAGGG + Intergenic
953665106 3:44920191-44920213 CATGCTCATGACCCACATGAAGG - Intronic
962175645 3:133151283-133151305 CTAGCCCCTAACCCAGTTTATGG + Intronic
962732577 3:138297296-138297318 CTTGCTGCTGACCCAGAAGTTGG - Intronic
963737348 3:149034935-149034957 CTTGCTTCTGACCAAGTCTATGG + Exonic
966050987 3:175617752-175617774 CTAGCTCCTGATTCAGTTGAAGG - Intronic
966473805 3:180321986-180322008 CTTGCTCCTCAGCCTGTAGAAGG - Intergenic
968602392 4:1516416-1516438 CTTGCTGGTGCCCCAGTAGAGGG - Intergenic
968954499 4:3711357-3711379 CCTGCTCCTGACCACGTGGAAGG - Intergenic
974250245 4:59375968-59375990 CTATCTCCTGACTCAGTCGAGGG - Intergenic
974697638 4:65396749-65396771 CTAACTCCTGATTCAGTTGAGGG + Intronic
978037310 4:104011101-104011123 CTTGTTCCTGATCCATTTCAGGG - Intergenic
978607598 4:110498686-110498708 CTGGCTTCTGACCCAGGTGACGG + Intronic
979832782 4:125321062-125321084 ATGGCTGCTGACCCAGATGAAGG + Exonic
982070900 4:151693508-151693530 CTTTCTCCTGACACTCTTGAGGG - Intronic
983461107 4:168026934-168026956 ATGTCTCCTGACTCAGTTGAAGG - Intergenic
984264687 4:177483623-177483645 CTTGCTACTGATCCAGCTGTAGG + Intergenic
985705610 5:1399923-1399945 CTTGCTCCTGCCCCATGTGCAGG + Intronic
986338504 5:6771866-6771888 CTTATTCTTGTCCCAGTTGAAGG + Intergenic
986667678 5:10117450-10117472 CCTGCTCCTGACCCCCTTCAAGG + Intergenic
989988578 5:50733331-50733353 CTTGCTCCTGACCTAACAGATGG + Intronic
991310505 5:65235704-65235726 CTTGCTCCTCAGCCTGTAGATGG + Intronic
994451467 5:99950140-99950162 CATGCTCCTTACCAAGTTGGTGG + Intergenic
995417342 5:111925628-111925650 CTGTCTCCTGACTCAGTTGAAGG - Intronic
998875415 5:146594067-146594089 CTTTCTCCTGAGCAAGTGGAAGG + Intronic
1001778053 5:174343966-174343988 CTTGCTCCTCACCAATATGAGGG - Intergenic
1001892390 5:175350375-175350397 CTGTCTCCTGACCCAGGTGCAGG - Intergenic
1002081739 5:176741495-176741517 CTTGCTCCTCACCCCGTCGTGGG + Intergenic
1007336208 6:41156968-41156990 CTACCTCCTGCCCCAGTTGTGGG - Intergenic
1009301779 6:62032448-62032470 CTTGCTCCTCAGCCTGCTGATGG + Intronic
1019645095 7:2124719-2124741 CTGTCTCCTGACCCAGAGGAGGG - Intronic
1024698648 7:51883416-51883438 CCTGCTCCTGCCCCAGCTTAGGG + Intergenic
1024986018 7:55193661-55193683 CTTGCTCCTGTCGCTGTAGATGG - Intronic
1031567164 7:123314526-123314548 CTTGCTTCAGACCCTGCTGAGGG - Intergenic
1035875941 8:3189796-3189818 CTGGCTCATGACCCATTTAAAGG - Intronic
1041909286 8:63071466-63071488 ATTTCTCATGGCCCAGTTGAAGG - Intronic
1041935222 8:63325535-63325557 CTATCTCCTGATTCAGTTGAGGG + Intergenic
1044800310 8:95946795-95946817 CTTGCTCCTGAGCCTATTGTGGG + Intergenic
1047495465 8:125405654-125405676 CTGGCTACTGCCCCAGTTCAGGG + Intergenic
1049295335 8:141830465-141830487 CCTGCTACTGACTCAGGTGATGG - Intergenic
1049314994 8:141960900-141960922 CTGTTTCCTGACCCAGTTGATGG + Intergenic
1049432046 8:142569710-142569732 CTTGCTCCAGGTCCAGCTGATGG - Intergenic
1050912068 9:11083731-11083753 ATTGCTCTTTACCCATTTGAAGG + Intergenic
1053790173 9:41681087-41681109 CTTGCTCCAGGCCCAGTGCAAGG + Intergenic
1054154965 9:61633670-61633692 CTTGCTCCAGGCCCAGTGCAAGG - Intergenic
1054178514 9:61892776-61892798 CTTGCTCCAGGCCCAGTGCAAGG + Intergenic
1054474756 9:65564778-65564800 CTTGCTCCAGGCCCAGTGCAAGG - Intergenic
1054659015 9:67688048-67688070 CTTGCTCCAGGCCCAGTGCAAGG - Intergenic
1055649430 9:78392795-78392817 CAAACTTCTGACCCAGTTGAGGG - Intergenic
1056950034 9:91034509-91034531 CTTGCTGCAGACCCAGATGCTGG + Intergenic
1057217397 9:93236666-93236688 GTGGCTCCTCACCCAGCTGATGG - Intronic
1059233999 9:112747020-112747042 CTTGCTACTGAACCAGCAGAGGG - Intergenic
1061044490 9:128157475-128157497 CCTGCCCCTGTCCCAGTTAAGGG + Intergenic
1062011605 9:134270094-134270116 CTTGCTCCTCCCACACTTGAGGG + Intergenic
1062514808 9:136927399-136927421 CCTGCAGCTGACCCAGTGGATGG - Intronic
1203489550 Un_GL000224v1:90444-90466 CTAGCTCCTGATCAAGTTGCAGG + Intergenic
1203502171 Un_KI270741v1:32332-32354 CTAGCTCCTGATCAAGTTGCAGG + Intergenic
1186753866 X:12649508-12649530 CTTGCTGCAGACCGAGTTGCAGG - Intronic
1189271643 X:39756115-39756137 CTTGCCGGTGACCCAGTTGCAGG + Intergenic
1193530477 X:82649072-82649094 CTATCCCCTGACTCAGTTGAGGG - Intergenic
1195853627 X:109308368-109308390 CTTTCTCCTGATTCAGTCGAGGG - Intergenic
1198127724 X:133662786-133662808 CTTGCTCCTGATCCTGATAATGG + Intronic
1198457734 X:136833813-136833835 CTTGCTCATGCCCTAATTGAAGG - Intergenic