ID: 1084874411

View in Genome Browser
Species Human (GRCh38)
Location 11:72120231-72120253
Sequence TAATGGATACAGTTTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 14, 3: 77, 4: 276}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084874401_1084874411 19 Left 1084874401 11:72120189-72120211 CCTGGAACCAATCCCCTACATCT 0: 1
1: 2
2: 43
3: 187
4: 662
Right 1084874411 11:72120231-72120253 TAATGGATACAGTTTCAGCTGGG 0: 1
1: 0
2: 14
3: 77
4: 276
1084874408_1084874411 5 Left 1084874408 11:72120203-72120225 CCTACATCTGTTGAGGGAGGATT 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1084874411 11:72120231-72120253 TAATGGATACAGTTTCAGCTGGG 0: 1
1: 0
2: 14
3: 77
4: 276
1084874407_1084874411 6 Left 1084874407 11:72120202-72120224 CCCTACATCTGTTGAGGGAGGAT 0: 1
1: 0
2: 1
3: 8
4: 272
Right 1084874411 11:72120231-72120253 TAATGGATACAGTTTCAGCTGGG 0: 1
1: 0
2: 14
3: 77
4: 276
1084874402_1084874411 12 Left 1084874402 11:72120196-72120218 CCAATCCCCTACATCTGTTGAGG 0: 1
1: 0
2: 2
3: 11
4: 136
Right 1084874411 11:72120231-72120253 TAATGGATACAGTTTCAGCTGGG 0: 1
1: 0
2: 14
3: 77
4: 276
1084874406_1084874411 7 Left 1084874406 11:72120201-72120223 CCCCTACATCTGTTGAGGGAGGA 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1084874411 11:72120231-72120253 TAATGGATACAGTTTCAGCTGGG 0: 1
1: 0
2: 14
3: 77
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084874411 Original CRISPR TAATGGATACAGTTTCAGCT GGG Intronic
900922303 1:5680939-5680961 GAAAGGATCCAGTCTCAGCTGGG + Intergenic
902188924 1:14746955-14746977 TAATGGATACAGTTTTCATTTGG - Intronic
902475640 1:16684337-16684359 TGTTGCATACAGTTTCAGTTTGG + Intergenic
903922150 1:26807494-26807516 TAATGGGTACAGTTTCAGTTTGG - Intergenic
904824862 1:33267533-33267555 TAATGGATCCAGTGTCAGGGTGG + Intronic
904859725 1:33526832-33526854 AAATGGTTACAGTTTAAGATAGG - Intronic
908130069 1:61066488-61066510 TAATGGATACAGAGTCAGCTTGG + Intronic
909257458 1:73441925-73441947 TAATGAGTACAGCTTCACCTAGG - Intergenic
910145921 1:84078921-84078943 TAATGGATAAAGTTGCTGTTGGG - Intronic
910372212 1:86528304-86528326 TAATGGGTAGAGTTTCAGTTTGG - Intergenic
911715929 1:101133031-101133053 TAATGGGTAGAGTTTCAGTTTGG + Intergenic
912243905 1:107940838-107940860 TAATGTATAGAGTTTCAGTTGGG + Intronic
912650807 1:111437240-111437262 TAATAAGTACAGTTTCAGTTTGG + Intergenic
912991555 1:114492503-114492525 TAATGGATATAGTTTCTGTTTGG - Intronic
913587011 1:120285454-120285476 TAGTGGCTACAGTTTCATTTGGG + Intergenic
913621174 1:120612916-120612938 TAGTGGCTACAGTTTCATTTGGG - Intergenic
914569025 1:148897339-148897361 TAGTGGCTACAGTTTCATTTGGG + Intronic
914603802 1:149232917-149232939 TAGTGGCTACAGTTTCATTTGGG - Intergenic
917102252 1:171458425-171458447 TAATGGGTAGAGTTTCAGTATGG + Intergenic
917992496 1:180396169-180396191 TAATGGTTAGAGTTTCAGTTGGG + Intronic
919076583 1:192820836-192820858 TATTGCATACAGTTACAGTTAGG - Intergenic
919238282 1:194875128-194875150 TAATAGATACAGTTTCTTTTGGG - Intergenic
919858530 1:201722221-201722243 TAATGGGTACAGTTTCTCTTTGG - Intronic
922018810 1:221682805-221682827 TAATGTATATAGTTTGATCTTGG - Intergenic
922480471 1:225937164-225937186 CAATGCACACATTTTCAGCTGGG - Exonic
922667522 1:227485387-227485409 CCATGGATAGAGTTTCAGTTTGG + Intergenic
923070966 1:230564096-230564118 TAATGGGTACAATTCCAGTTTGG + Intergenic
923180856 1:231518125-231518147 TAATGGAAACAGAGTCAGGTAGG - Intergenic
923366557 1:233267483-233267505 TAATGGGTACAGTTTCAGTTTGG - Intronic
923535127 1:234843527-234843549 TAATGGGTACAGTTTCAGTTTGG + Intergenic
1064141143 10:12791443-12791465 TAAGGGGTAGAGTTTCAGTTTGG - Intronic
1065065707 10:21961602-21961624 TAAAGGGTACAGTTTCTGTTTGG + Intronic
1065076241 10:22082439-22082461 TAATGGATATGGTTTCAGTTTGG + Intergenic
1065442084 10:25763165-25763187 TAATGGATCCAATCGCAGCTGGG + Intergenic
1065885995 10:30077552-30077574 TAATGAATACAGTTTCTGTTTGG - Intronic
1066690879 10:38026818-38026840 TAATGGCGACAGTTTCTGTTTGG - Intronic
1067191252 10:44070054-44070076 TAAGGGGTACAGTTTCAGTTTGG + Intergenic
1067756102 10:49006916-49006938 TAATGGGGACAGTTTCAGTTTGG + Intergenic
1067936538 10:50617123-50617145 TAATGGGGACAGTTTCAGTTTGG + Intronic
1069664846 10:70147407-70147429 GAATGGAAACAGTTCCAGTTTGG + Exonic
1070566280 10:77605931-77605953 CCATGGATTCAGTTCCAGCTCGG - Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072901491 10:99411540-99411562 GAGTGGATACAGTTTTAACTAGG - Intronic
1072970261 10:100010893-100010915 TAATGGGTACAGTTTCAGTTTGG - Intergenic
1073315017 10:102573852-102573874 TACTGTATAGAGTTTCAGTTGGG + Intronic
1073388650 10:103151783-103151805 AAATGGATACATTTTGTGCTTGG - Intronic
1073685969 10:105753915-105753937 TAATGGATATAGTACCAGTTTGG + Intergenic
1074393460 10:113077453-113077475 TAATGGGTACAGTTTCTTTTAGG - Intronic
1075423780 10:122326307-122326329 TCATGGGTAGAGTTTCAGTTTGG - Intronic
1076281158 10:129247456-129247478 TAATGCATACAATCTCAGTTTGG + Intergenic
1076579644 10:131498602-131498624 TAATTCCTACAGTTTCAGCACGG + Intergenic
1077348228 11:2074458-2074480 TAATGGAGACAGTTTCAGTAGGG - Intergenic
1077811085 11:5637704-5637726 TAATGGGTACAGTTTCAGTTTGG - Intronic
1077913246 11:6592736-6592758 TAATGGATAAAGTTCAACCTCGG - Intronic
1078241273 11:9532725-9532747 TAATGGGTACAATTTCAGTTTGG - Intergenic
1080221556 11:29911326-29911348 TAATGTATACAATTTGAGTTTGG - Intergenic
1080510159 11:32961585-32961607 TAATGGTTACAGTTTCTGTTTGG - Intronic
1081620390 11:44615849-44615871 TAATGGGCACACATTCAGCTTGG - Intronic
1082096388 11:48133975-48133997 TAATGGCTACAGTTTATGCTGGG + Intronic
1082897329 11:58205670-58205692 TATTGGAAATAATTTCAGCTTGG + Intergenic
1083704892 11:64507284-64507306 TAATGGACAGAGCTTCAGTTTGG - Intergenic
1084130781 11:67132636-67132658 TAATGTCTCCAGTTTCAGGTCGG + Intronic
1084574444 11:69979852-69979874 TCATGGAGAAAGTCTCAGCTTGG + Intergenic
1084791762 11:71479527-71479549 TAATGGGTACAGTTTCTTTTTGG - Intronic
1084874411 11:72120231-72120253 TAATGGATACAGTTTCAGCTGGG + Intronic
1085376791 11:76070858-76070880 TAATGATTACAGTTTCCGTTGGG + Intronic
1085422560 11:76376079-76376101 TAATGGTTACAGTTTTTGTTTGG + Intronic
1085656168 11:78317158-78317180 TAATGGGTATAGTTTCAGTTTGG + Intronic
1087278085 11:96180384-96180406 AAAAGGATACAGTTTCCACTTGG + Intronic
1087284181 11:96246782-96246804 TAATATATACAGTTTGAGGTTGG + Intronic
1087529584 11:99361605-99361627 TAATGGACACGGTTTCTGTTTGG - Intronic
1089102105 11:115971905-115971927 GAAGGGATCCAGTTTCAGCTTGG - Intergenic
1089655176 11:119941923-119941945 TAATGGATCCAGATTCAGAGTGG - Intergenic
1091339423 11:134798761-134798783 TTATGGATACAGCTTAGGCTTGG - Intergenic
1092727015 12:11496875-11496897 TCATGGGTAGAGTTTCAGGTTGG - Intronic
1092952537 12:13520566-13520588 TCATGGATTCAGTTTCTTCTTGG + Intergenic
1093845834 12:23970411-23970433 TAATGGTTAGAGTTTCTGTTAGG - Intergenic
1096098069 12:48950634-48950656 TAACAGGTACAGTTTCAGTTTGG - Intronic
1096166347 12:49428398-49428420 TAATGGGTACAGTTTCAGTTTGG - Intronic
1097700575 12:62816154-62816176 TAATGGATACAGAGGCAGCATGG + Intronic
1100881318 12:99020213-99020235 TAATGGGTACAGTTTCAACTGGG - Intronic
1101760421 12:107653905-107653927 TAAAGGGTACAGTTTCAGTTTGG - Intronic
1101936576 12:109062830-109062852 TCATGGGTACAGTTTCAGTACGG - Intronic
1102444626 12:112992465-112992487 TGATGGCTTAAGTTTCAGCTTGG - Intronic
1103740136 12:123085534-123085556 TAATGGGTGCAGTTTCTGTTTGG + Intronic
1104186070 12:126432861-126432883 TCAGGGATAGAGTATCAGCTTGG - Intergenic
1104654659 12:130564986-130565008 TAATTTATACAGTTTGAGTTTGG - Intronic
1105370830 13:19800471-19800493 TAGTGGGTAGAGTTTCAGTTTGG - Intergenic
1105890522 13:24679799-24679821 TCATGTATAGAGTCTCAGCTGGG + Intergenic
1106034661 13:26032912-26032934 TAACCGGTACAGTTTCAGTTTGG + Intergenic
1106181143 13:27370386-27370408 TAATGGGTGCAGTTTCAATTTGG - Intergenic
1107541699 13:41394888-41394910 GAATGGATTCAGATTCTGCTGGG + Intergenic
1108724774 13:53168003-53168025 AAATGGAAACTGTTTCATCTGGG + Intergenic
1112155518 13:96812684-96812706 TAATGGGAACAGTTTCACTTAGG - Intronic
1112477795 13:99748061-99748083 TAATGGGTATAGTTTCAGTTCGG - Intronic
1112527412 13:100164807-100164829 TAATATGTACAGTTTCAGTTTGG - Intronic
1112837247 13:103531061-103531083 AAATGGAGACAGTCCCAGCTTGG - Intergenic
1113014363 13:105810981-105811003 TAATGGCTACAGTTACAGGAAGG - Intergenic
1115141728 14:30179504-30179526 TGATGGATAGAGTATGAGCTGGG + Intronic
1115273556 14:31581352-31581374 TAATGAATAGAGTTTCAGTTTGG - Intronic
1117290532 14:54327815-54327837 TTATGGATAGAGTTTCATCTGGG - Intergenic
1117353898 14:54905313-54905335 TAAGGGATTCATTTTCAGCTTGG + Intergenic
1117902939 14:60553985-60554007 TAATAGATACAGCTGCTGCTGGG - Intergenic
1119710029 14:76814876-76814898 TAAAGGATCCAGTCTCAACTGGG + Intronic
1119925928 14:78493656-78493678 TAATGGATTCAGCTTCATATAGG + Intronic
1121770091 14:96526629-96526651 TAAAGAATACAGCCTCAGCTGGG - Intronic
1121874792 14:97441428-97441450 TAGTGGCCAAAGTTTCAGCTCGG - Intergenic
1124923845 15:34051785-34051807 TAAGGGATTCAGTTTCTTCTTGG - Intronic
1125858683 15:42976559-42976581 TAATGGATACTGTTTAAACAAGG - Intronic
1130004961 15:80086784-80086806 TAATGGGTACAGTTTCAGTTTGG - Intronic
1131775875 15:95798075-95798097 TAATGTTGACAGTCTCAGCTTGG - Intergenic
1132753441 16:1470066-1470088 GAATGGGTGCAGTTTCAGTTTGG + Intronic
1132759921 16:1503728-1503750 TCACGGGGACAGTTTCAGCTTGG + Intronic
1133520876 16:6555402-6555424 TAAAGGATACCATTCCAGCTGGG + Intronic
1134014975 16:10881794-10881816 TATTGGGTAGAGTTTCAGTTTGG - Intronic
1135825363 16:25722541-25722563 ATATGGATACAGTGTCACCTGGG + Intronic
1138052108 16:53790244-53790266 TAATTGGTACAGTTTCAGTATGG - Intronic
1138380506 16:56598575-56598597 TTATGGATAGAGTTTCAGTTTGG - Intergenic
1138917012 16:61477039-61477061 TCATGGATACTGTTTTAGCTAGG + Intergenic
1139941014 16:70605479-70605501 TAATGGGTAGAGTTTCATTTGGG - Intronic
1140339377 16:74141900-74141922 TAGTGGCTCCAGTTTCTGCTAGG - Intergenic
1142726179 17:1816098-1816120 TAATGGGTAGAGTTTCAGCATGG - Intronic
1142880707 17:2880599-2880621 TAATGGATACAGTTTCCATCTGG - Intronic
1143831645 17:9656761-9656783 TAATGAATAGAGTTTCATTTTGG + Intronic
1145235561 17:21205668-21205690 TCATGGGTAGAGTTTCAGTTTGG - Intronic
1145271941 17:21409503-21409525 TCATTGATACAGTTACTGCTGGG + Intronic
1145780274 17:27558394-27558416 TAAGAGATACAGTTTCATCAAGG + Intronic
1147772084 17:42874732-42874754 TAAAGTATACAATTTCAGCCGGG + Intergenic
1151223338 17:72630306-72630328 TAGTAGATATAGTTGCAGCTTGG + Intergenic
1151612284 17:75183862-75183884 TTATGGATACTGTTTCCTCTTGG - Intergenic
1151722607 17:75866109-75866131 TAATGGGGACAGTTTCAGTGTGG - Intergenic
1152096514 17:78275329-78275351 TAATGGGGACAGTTTCAGTTTGG - Intergenic
1152481784 17:80559058-80559080 TAATGGAGACAGTTTCAGTCTGG - Intronic
1153261390 18:3227486-3227508 TAATGGGTAGAGTTTCAACATGG + Intergenic
1153825069 18:8867523-8867545 TAATGGATACAGTTTTGCTTTGG + Intergenic
1154946794 18:21169882-21169904 TAATGGATACAGTTTCTTTTTGG + Intergenic
1156364562 18:36413872-36413894 TAATAGTTACAGTTTCTGTTAGG - Intronic
1157321048 18:46634814-46634836 TAATGGGCACAGTTTCAGGGTGG + Intronic
1157504140 18:48214258-48214280 TATTGGAGACAGTTTCAGTTTGG - Intronic
1161245277 19:3248341-3248363 ACAGGGATACAGTTTCAGTTTGG - Intronic
1162221158 19:9177658-9177680 TACGGGACAGAGTTTCAGCTTGG + Intergenic
1162521346 19:11181627-11181649 TAATGGGGACAGTTTCAGTTTGG + Intronic
1164684738 19:30159213-30159235 TTCTGCATTCAGTTTCAGCTGGG - Intergenic
1168410745 19:56138714-56138736 TAATGGGTACAATTTCAATTTGG + Intronic
925568109 2:5279064-5279086 ATATGGATATAGATTCAGCTGGG - Intergenic
925747395 2:7055269-7055291 TCAGAGAAACAGTTTCAGCTGGG - Intronic
927499715 2:23574571-23574593 TAATGGGTAGAGTTTCTGTTTGG + Intronic
927655479 2:24941748-24941770 TAAAGGAAATAGTTCCAGCTGGG - Intergenic
927704496 2:25288755-25288777 GAATGGAGACAGTTTCCGTTTGG - Intronic
929359084 2:41062011-41062033 TAATGTATACATTATCAGTTTGG + Intergenic
929738033 2:44572108-44572130 TAATGGGTACAGTCTCAGTCTGG - Intronic
930183818 2:48390932-48390954 TAATGAATACAGTTTCTGTTTGG - Intergenic
933531156 2:83514005-83514027 TTATGGGTACAGTTTCTGTTTGG + Intergenic
935732875 2:106079144-106079166 TAAAGGATACAGTATCAGTTTGG - Intergenic
936064473 2:109320011-109320033 GAATGGAAACAGCTCCAGCTGGG - Intronic
936134649 2:109879541-109879563 TAATGGACACCGTCTCAGCCAGG - Intergenic
936210048 2:110491944-110491966 TAATGGACACCGTCTCAGCCAGG + Intergenic
936429241 2:112447416-112447438 TAATGGACACCGTCTCAGCCAGG + Intergenic
937964254 2:127489469-127489491 TAGTGGATACAGTTGCATCCAGG - Intronic
938395120 2:130940314-130940336 GAATGGATAAAGTTTCAGCAGGG + Intronic
938648488 2:133355194-133355216 CAATGGCTACAGTTTAAGATAGG - Intronic
938870698 2:135473116-135473138 TAATGGGTAGAGTTTTAGTTTGG - Intronic
939858170 2:147386030-147386052 AAATGATTACAGTTTCAGGTTGG + Intergenic
940228325 2:151423919-151423941 TAATGGGTACAGTTTTTGTTAGG - Intronic
940495324 2:154420343-154420365 TAATGGAGACAAATTCATCTTGG - Intronic
940804191 2:158167471-158167493 TAATGGAAACCTTTTCAGTTTGG - Intergenic
942662275 2:178278662-178278684 TAATGGAAACAGGTTGTGCTGGG - Intronic
943478420 2:188387550-188387572 TAATGGTAACACTTTCAGCTTGG + Intronic
943727725 2:191269123-191269145 TAACGGCTACAGTTTTAGTTTGG - Intronic
945157511 2:206855149-206855171 GAATGGGCACAGTTTCAGTTTGG + Intergenic
945551600 2:211228040-211228062 TAATGTTTAGAGTTTCTGCTTGG + Intergenic
947164081 2:227243693-227243715 AAATGGTGACTGTTTCAGCTAGG - Intronic
947434156 2:230058518-230058540 TATTGAATACAGTTTCCGTTTGG + Intronic
947784050 2:232798897-232798919 TAATGTATACAGTTCCAATTTGG - Intronic
1169370324 20:5023948-5023970 TCATGGGTAGAATTTCAGCTGGG - Intergenic
1169670627 20:8096926-8096948 TAATGGATAGAGTTTCTTTTAGG - Intergenic
1170638488 20:18130287-18130309 TAATGGACACAGTTTCTGTTTGG + Intergenic
1173612298 20:44378663-44378685 TAATGGGTACAGTTTCAGTGTGG - Intronic
1173683205 20:44902133-44902155 TAATAGATACAGCTACAGATAGG + Intronic
1173956704 20:47038727-47038749 CAATGGATATAGTTTCAGTTTGG - Intronic
1175352586 20:58335755-58335777 TAAAGAATACAGTTACAGTTTGG + Intronic
1175638350 20:60604169-60604191 TCATTTTTACAGTTTCAGCTAGG - Intergenic
1178248398 21:30976259-30976281 TAACAGATACAGTTTCAGTAGGG + Intergenic
1179031939 21:37728324-37728346 TAATGGGGACAGTTTCTGTTTGG + Intronic
1180240967 21:46505311-46505333 TAAAGTGTACAGTTTCGGCTGGG + Intronic
1180863575 22:19102293-19102315 TAATGGGTATAGTTTCTGTTTGG + Intronic
1183798266 22:40139063-40139085 TAATGGATACAGTTTCTTTTTGG - Intronic
1185011715 22:48318321-48318343 TAATGGGGACAGTTTCATTTTGG - Intergenic
949654551 3:6202224-6202246 TAATGGATACAGTTTTTGTGAGG - Intergenic
950203352 3:11060093-11060115 TCATGGGTGCAGTTTCAGCTGGG + Intergenic
950514807 3:13457782-13457804 TCATGGGAACAGTTTCAGTTTGG + Intergenic
950769337 3:15298826-15298848 GAATGGGTACAGTTTCAGTCTGG + Intronic
950936489 3:16844450-16844472 TACGACATACAGTTTCAGCTAGG - Intronic
951205928 3:19925955-19925977 TAATGGATTCAGTGTCTTCTGGG - Intronic
951716678 3:25655897-25655919 TAGTAGATATAGTTTCAGTTTGG + Intronic
952309628 3:32176567-32176589 TAAAGGAGGCAGTTTCAGCAAGG + Intergenic
952342621 3:32458541-32458563 TAATGGGTACAGTTTCAGTTTGG + Intronic
953557164 3:43955512-43955534 GAAAGGATATATTTTCAGCTCGG + Intergenic
953865927 3:46583560-46583582 TAATAGGTAGAGTTTCAGCTTGG - Intronic
953964530 3:47293153-47293175 TAATGGGTATAGTTTCAGTTTGG + Intronic
955272425 3:57514783-57514805 TTATTAATACATTTTCAGCTAGG - Intronic
955544134 3:60009756-60009778 TAATGGATACAGGTTCTTTTAGG - Intronic
956315591 3:67932181-67932203 TAATGGGTAAAGTTTTAGTTTGG + Intergenic
956322570 3:68014088-68014110 GAATGTACACAGATTCAGCTTGG - Intronic
956590757 3:70912235-70912257 TAATGGGTGCAGTTTCGGTTGGG - Intergenic
957323269 3:78659769-78659791 TCTTGGATACAGTTACACCTTGG + Exonic
958142678 3:89582670-89582692 TAATGGTTACAGCTTCAGTTTGG - Intergenic
958707887 3:97678932-97678954 TAAAAGATAGAGTTTCAGATTGG - Intronic
959133776 3:102391495-102391517 AAAGTGATACAGTTTCTGCTTGG + Intronic
959613076 3:108316617-108316639 AAAGGGAGACAGTTACAGCTAGG + Intronic
960848360 3:122025597-122025619 TCATAGACACAGTTTCAACTAGG - Intergenic
960948104 3:122980780-122980802 TAATGGGTAGAGTTTCAGCAGGG - Intronic
961002369 3:123382778-123382800 TAATGGGTAGAGTTTCTGTTTGG + Intronic
961079288 3:124011838-124011860 TACTGGATGCAGTTTCAGTGGGG + Intergenic
961304187 3:125944626-125944648 TACTGGATGCAGTTTCAGTGGGG - Intergenic
961416328 3:126760460-126760482 TGATGGGTACAGTTTCAGTTTGG - Intronic
964911086 3:161781064-161781086 TTACTGATACATTTTCAGCTTGG + Intergenic
965164618 3:165180805-165180827 TAATGGAGAAAGTTTGAACTAGG - Intergenic
965578959 3:170246787-170246809 TAATGGGTACAGTTTCTGATTGG - Intronic
965844335 3:172944852-172944874 TAATGGGTAGAGTTTCAGTTTGG + Intronic
967556974 3:190871427-190871449 TAGTAGATACATTTTCATCTAGG - Intronic
968034182 3:195531824-195531846 TAATGAGTACAGTTTCAGTTGGG - Intronic
971626720 4:28930178-28930200 TAGTGAAAAAAGTTTCAGCTTGG - Intergenic
971851633 4:31992622-31992644 TAATGTATACTGGTTCAGGTAGG + Intergenic
972531551 4:39965808-39965830 TAATGGGTAGAGTTCCAGTTGGG + Intronic
972816577 4:42652966-42652988 TAATGGACTCAGTTTCACATCGG - Intronic
972988807 4:44798647-44798669 TAAGGGATCCAGTTACAGCTTGG + Intergenic
973902093 4:55485937-55485959 TAAAGGATCAAGTTACAGCTAGG + Intronic
974833058 4:67212591-67212613 TAATAGATACAATTTAAGTTAGG + Intergenic
974975528 4:68886798-68886820 TTATAGTTACAGTGTCAGCTAGG - Intergenic
977091138 4:92677141-92677163 TAATGTGTACAGTTTCAGTAGGG + Intronic
977211771 4:94226665-94226687 TATTGGAAACAGTCTGAGCTAGG + Intronic
978162383 4:105564517-105564539 TAATGGGTAGAGTTTCAATTTGG + Intronic
979979974 4:127242806-127242828 TAAAGGATACAGTTGTGGCTGGG - Intergenic
980161328 4:129167148-129167170 TAATGTATACAATTTGAGTTTGG + Intergenic
980824610 4:138058543-138058565 TAATGGGTAAAGTTTCTCCTTGG - Intergenic
980997174 4:139790511-139790533 TAATGGATACAGTTTCTATTTGG - Intronic
982668909 4:158297230-158297252 TAATGGATTCCATTTTAGCTGGG + Intergenic
984004153 4:174288159-174288181 TAATGTATACAGTTTCTGTTTGG + Intronic
984730450 4:183063519-183063541 TAATAGCTACAGAATCAGCTTGG - Intergenic
986833575 5:11609173-11609195 TAATATGTACAGTTTCAGATAGG - Intronic
987349037 5:17004983-17005005 TAATGCTTCCATTTTCAGCTGGG - Intergenic
989083865 5:37655016-37655038 TAATTGATACAGTTTCTTCATGG + Intronic
991232859 5:64356848-64356870 TAATGGCTACAGTTTCTGTTTGG + Intronic
991469258 5:66950386-66950408 TAATGGAAAAAGTTTCAGTTGGG - Intronic
991531941 5:67624964-67624986 TAATGGGTACAGCTTCAGGTTGG - Intergenic
991975717 5:72182199-72182221 TAGTGGGTACAGTTTCTGTTTGG - Intronic
992302651 5:75399948-75399970 TAATGGAGACAGTTTCACCATGG - Intronic
992384061 5:76266683-76266705 TCATGGGTAGAGTTTCAGTTTGG + Intronic
993397645 5:87410810-87410832 TTATGGTATCAGTTTCAGCTGGG + Intronic
993684450 5:90921095-90921117 TAATGGTTACACTTTCATTTGGG - Intronic
994261132 5:97659981-97660003 TAATGGATAGAGTTTTAATTTGG + Intergenic
994531145 5:100973268-100973290 TAATGAAGAGAGTTTCAGCCTGG + Intergenic
995605422 5:113849330-113849352 TAATGGGTAGAGTTTCAGTATGG - Intergenic
995701739 5:114943129-114943151 TAATGGGTAGAGTTTCAGCTGGG + Intergenic
997618529 5:135270123-135270145 TAATAGATTCAGTTTCTGTTGGG + Intronic
998893904 5:146777492-146777514 TAATGGGTGCAGTTTCTGTTTGG + Intronic
999365948 5:151023502-151023524 TTCTGGGCACAGTTTCAGCTTGG - Intronic
1000137145 5:158363817-158363839 TAGTGGTGACACTTTCAGCTGGG - Intergenic
1000201438 5:159014846-159014868 TAATGGCTACAGCTCCATCTTGG + Intronic
1000218070 5:159183749-159183771 CAATGGATACAGTTTAAACAGGG + Intronic
1000409284 5:160920913-160920935 TTAAGGATACAGTCTCAGTTTGG + Intergenic
1000535258 5:162470967-162470989 TAATGGATAGGGTTTGGGCTGGG - Intergenic
1001623696 5:173111518-173111540 GAAAGAATACAGATTCAGCTGGG - Intronic
1001631467 5:173178584-173178606 TAATGGGTAGAGTTTCAGTTCGG + Intergenic
1001879371 5:175229935-175229957 TAATGAAGAGAGTTCCAGCTTGG + Intergenic
1002772957 6:304814-304836 TAAGGGACACAGTTTCAGTTTGG - Intronic
1002838667 6:887120-887142 TAATGGGTACAGTCTCAGCCTGG - Intergenic
1003137156 6:3442283-3442305 TCATGGGGACAGTTTCAGTTTGG + Intronic
1004296174 6:14413511-14413533 TAAAGGATAGAGTTTCTGTTTGG - Intergenic
1004759673 6:18652618-18652640 TAATGGGTGCAGTTTCAGTTTGG + Intergenic
1004772853 6:18805066-18805088 AAATTGATACAGCTTTAGCTGGG - Intergenic
1005839223 6:29730415-29730437 TAATGGGTCCAGTTTCTGTTGGG + Intronic
1005853123 6:29837801-29837823 TAATGGGTACAGTCTCTGTTGGG + Intergenic
1005876727 6:30016275-30016297 TAATGGGTACAGTTTCTGTTTGG + Intergenic
1006620932 6:35363450-35363472 TGAGGGATACAGTTTCACATGGG - Intronic
1008029809 6:46681922-46681944 TAGTGTGTACAGTTTCAGTTTGG + Intergenic
1008332141 6:50258188-50258210 TCAGGGATTCAGTTTCATCTTGG + Intergenic
1008661893 6:53677306-53677328 TCATGAGTACAGTTTCAGTTTGG - Intergenic
1010655272 6:78504379-78504401 CAATGGACACACTTTCAGTTTGG + Intergenic
1013453735 6:110310902-110310924 CAATGGATGCAGCTGCAGCTGGG - Intronic
1015143973 6:129965237-129965259 TAACGGGTACAGTTTCAACTTGG + Intergenic
1015511972 6:134046967-134046989 TATTTGACTCAGTTTCAGCTGGG + Intronic
1015688407 6:135892856-135892878 TCATTTATACAGCTTCAGCTTGG - Intronic
1015901070 6:138067615-138067637 TAATGGATAAAGTAGCAGCAGGG + Intergenic
1015993094 6:138968864-138968886 TCATGGAGAAAGTTGCAGCTTGG - Intronic
1016409774 6:143770372-143770394 TAATGGGTAGAGTTTCAATTTGG + Intronic
1016872347 6:148830829-148830851 TAATGTGTAGAGTTTCAGTTTGG + Intronic
1017138577 6:151169868-151169890 TAATGGATACGGTTTCAGTTTGG - Intergenic
1018022515 6:159775165-159775187 TTTTGGCTACATTTTCAGCTGGG - Exonic
1018228512 6:161654270-161654292 TGATGTATACATTTTCAGGTAGG - Intronic
1018688665 6:166324777-166324799 TAATGGATATAGTTTTAGAAAGG - Intronic
1018968170 6:168504844-168504866 TAATACATTCAGTTTAAGCTGGG + Intronic
1019097514 6:169595984-169596006 TAAGGGAAAGAGTATCAGCTTGG - Intronic
1019501408 7:1366672-1366694 TAATGAATACACGTCCAGCTTGG - Intergenic
1020160609 7:5768476-5768498 TACTGGATAAAGTGTCAGTTAGG - Intronic
1020171764 7:5850567-5850589 TAATGGGGACAGTTTCAGTTTGG + Intergenic
1020411019 7:7891675-7891697 TAATGGGTACAGTTTCCGTTTGG + Intronic
1020494560 7:8833012-8833034 TAATTGATACAACTTGAGCTAGG + Intergenic
1021280982 7:18718094-18718116 TAATGGGTACAGTTTCTTTTGGG - Intronic
1021859593 7:24893483-24893505 TAATGGCTACAGTTTCTTTTTGG + Intronic
1022031993 7:26500238-26500260 TAATGAGTAGAGTTTCAGTTTGG - Intergenic
1022175216 7:27865845-27865867 TAAAGGATACTGAATCAGCTGGG - Intronic
1023879608 7:44310812-44310834 TAATGGGGACAGTTTCACTTAGG + Intronic
1028040165 7:86041882-86041904 TAATGGGTACAGTTTCTGTTTGG + Intergenic
1028576724 7:92360190-92360212 TAATGGTTATAGTTTCTGCTTGG - Intronic
1029086915 7:98019008-98019030 TAATGGGGACAGTTTCAGTTTGG - Intergenic
1031837447 7:126695457-126695479 TGATGTTTACAGTTTCAGCTAGG - Intronic
1032864097 7:135908830-135908852 TAATGGGTACAGTTTCTGTTTGG + Intergenic
1033861008 7:145627722-145627744 TAATGAATTCAGTTGCAGGTAGG + Intergenic
1034733787 7:153411120-153411142 TGATGGAGAGAGTTTCAGTTTGG + Intergenic
1036432011 8:8700488-8700510 TAGTGGGTACAGTGTCAGTTTGG + Intergenic
1036921833 8:12863677-12863699 TAATGAGTACAGTTTCTGTTTGG - Intergenic
1037697525 8:21238371-21238393 TAAAGGATAAAATGTCAGCTAGG + Intergenic
1038204114 8:25448404-25448426 TAATGGTTACAATTTCTGTTTGG + Intronic
1038342893 8:26702621-26702643 TATTTGAAACAGTTCCAGCTGGG + Intergenic
1038487592 8:27947999-27948021 TAGTGGATGCAGTTTCAGCTTGG + Intronic
1040389786 8:46940014-46940036 TAATAGGTAGAGTTTCAGTTTGG + Intergenic
1040585097 8:48732969-48732991 TAATGGGTAGAGTTTCCACTGGG + Intronic
1041089261 8:54287074-54287096 TAATGGTTACAGTTTCCGTTTGG - Intergenic
1041188784 8:55331088-55331110 TCATGCGTACAGTTTCAGTTTGG - Intronic
1041847713 8:62350487-62350509 TAATGGATAGAGTTACAGCGTGG + Intronic
1042786601 8:72554076-72554098 TCAGGGAGACAGTTTCAACTAGG + Intronic
1044865893 8:96570934-96570956 TAATGGGTAGAGTTTCAGTTTGG + Intronic
1045576065 8:103421556-103421578 TAATGACTATAGTTTCAGCTGGG - Intronic
1046051653 8:109029967-109029989 TAATGGATACAGTATAATCATGG - Intergenic
1046482937 8:114846991-114847013 TAAAGACTACAGTTTCAGCAGGG - Intergenic
1047257225 8:123223977-123223999 TAATGGGTAGAGTTTCTGTTTGG + Intronic
1048648340 8:136447351-136447373 TAATGGATTCAGTTCCACATGGG - Intergenic
1049718064 8:144103016-144103038 TAATGGATACAATTACAATTTGG - Intronic
1050771763 9:9210061-9210083 TAATGAAAACATTTTCCGCTGGG - Intronic
1051533603 9:18132413-18132435 CAATGGGTAGAGTTTCAGTTTGG - Intergenic
1052394888 9:27927065-27927087 AAATGGATATAGTCCCAGCTTGG - Intergenic
1053552129 9:39093490-39093512 TAATGAATACAGTTTAATTTTGG - Intronic
1054106521 9:61057321-61057343 TAATGAATACAGTTTAATTTTGG - Intergenic
1054614336 9:67273804-67273826 TAATGAATACAGTTTAATTTTGG + Intergenic
1054705525 9:68457323-68457345 TATTGGATTCTGTTTCAGCAAGG - Intronic
1054801684 9:69356095-69356117 TAATGGATATAGTTTCTACTTGG - Intronic
1054966384 9:71032395-71032417 AAATGTATACATTTTCAGGTGGG - Intronic
1055779921 9:79809439-79809461 TAAAGGAGACAATTTAAGCTTGG + Intergenic
1055987531 9:82066749-82066771 TAATAGATATAGATTCAGTTGGG + Intergenic
1056149355 9:83769352-83769374 TAATGGGTACAGTTTCTTTTTGG - Intronic
1057295334 9:93831672-93831694 TCATGGGTACAGTTTCTGTTTGG - Intergenic
1057461103 9:95262967-95262989 TAATGGGTAGAGTTTCTGTTTGG + Intronic
1057513779 9:95703695-95703717 GAGTGGAGACAGCTTCAGCTTGG + Intergenic
1059289081 9:113206040-113206062 TAATGGTTACACTTTCTGTTTGG + Intronic
1060034824 9:120245833-120245855 TAACGTGTACAGTTTCAGTTCGG + Intergenic
1060090653 9:120739901-120739923 AAACAGATACAGTTTCAGCCAGG + Intergenic
1060141133 9:121211191-121211213 TAATGAGTACAGTTTCAGTTTGG + Intronic
1061143508 9:128782970-128782992 TAATGGTTACAGTTTCTATTTGG - Intergenic
1062557050 9:137117867-137117889 TAATGGCTACAGTTTCTACTGGG - Intergenic
1186087693 X:6008806-6008828 TAATGGATAGAGTTTCAGTTTGG - Intronic
1186580269 X:10810132-10810154 TAATGAACACAGTTTCTGTTTGG - Intronic
1187324118 X:18270713-18270735 TACTGAATAGAGTTTCAGCATGG - Intronic
1187961393 X:24569776-24569798 TAATGGTTACAGTTTCTGTTTGG + Intronic
1188364300 X:29295737-29295759 TGATGGACAGAGTTTCATCTTGG - Intronic
1188413296 X:29900866-29900888 TGATGGATACAGGCTAAGCTGGG + Intronic
1189851504 X:45181473-45181495 TAATTAATACAGTTTCATATTGG + Intronic
1192276177 X:69633476-69633498 TAATGGATACAGTTTCTTTGGGG - Intronic
1194874589 X:99171205-99171227 TGATGGTCACAGGTTCAGCTTGG - Intergenic
1195304698 X:103569381-103569403 TAATGGGTACAGCTTCAGTTTGG + Intergenic
1195495630 X:105529693-105529715 TAATTGGTACAGTTTCAGTTTGG - Intronic
1195950070 X:110261061-110261083 TAATGGGTAGAGTTTCAGTTGGG + Intronic
1198943520 X:141984657-141984679 TAATGGACACATTATTAGCTTGG - Intergenic
1200759222 Y:7021671-7021693 TAATGGCTTCAATTTCAGCAAGG - Intronic
1200863688 Y:8019890-8019912 GAATGAAAACAGTGTCAGCTGGG + Intergenic
1200932707 Y:8711536-8711558 TACTGGAAACATTTTCAGCCTGG - Intergenic
1201952298 Y:19578879-19578901 ACATGGATACAGGTCCAGCTTGG - Intergenic