ID: 1084876898

View in Genome Browser
Species Human (GRCh38)
Location 11:72139741-72139763
Sequence AGCCCAGGGCAACCCCAATG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 2, 1: 3, 2: 2, 3: 16, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084876894_1084876898 4 Left 1084876894 11:72139714-72139736 CCGCTGCATCCAGATGTGGTTTG 0: 2
1: 3
2: 1
3: 15
4: 208
Right 1084876898 11:72139741-72139763 AGCCCAGGGCAACCCCAATGAGG 0: 2
1: 3
2: 2
3: 16
4: 248
1084876895_1084876898 -5 Left 1084876895 11:72139723-72139745 CCAGATGTGGTTTGACTCAGCCC 0: 1
1: 1
2: 3
3: 11
4: 201
Right 1084876898 11:72139741-72139763 AGCCCAGGGCAACCCCAATGAGG 0: 2
1: 3
2: 2
3: 16
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084876898 Original CRISPR AGCCCAGGGCAACCCCAATG AGG Exonic
900412195 1:2517666-2517688 AGGCCAGGGCAAACCCACTGGGG + Intronic
901185880 1:7372919-7372941 GGCCCAGGGCCACTTCAATGGGG - Intronic
902651387 1:17839899-17839921 AGACCTGGACAACCCCAGTGGGG - Intergenic
903442035 1:23395387-23395409 AGCACAGGGCCACTCCAAAGAGG + Intronic
903891730 1:26574326-26574348 AGCCCAGAACACCCCTAATGAGG + Intronic
905342988 1:37292058-37292080 AGCCCACAGCAACGCCAAGGTGG + Intergenic
905441973 1:38001453-38001475 AAACCAGGGCAACCCAAATAGGG + Intronic
907296674 1:53460074-53460096 AGCCCAGGCCAGCCCGGATGGGG + Intronic
913180034 1:116312137-116312159 AGCCCAGGGCACCTTCAATTAGG - Intergenic
916921430 1:169471879-169471901 ATCCCAAAGCAACCCCAGTGTGG + Intronic
918373177 1:183881938-183881960 AGCCAGGGGCAGCCCCAGTGGGG - Intronic
921162652 1:212484047-212484069 AGCCTGTGGCAACCCCACTGGGG - Intergenic
1065072679 10:22042640-22042662 AGCTCTGCTCAACCCCAATGTGG - Intergenic
1069494991 10:68895767-68895789 AGGCCTGAGCAACCCCACTGTGG + Intergenic
1070755997 10:78993691-78993713 AGCCCAGGGCCAGCCCACCGAGG + Intergenic
1073066453 10:100762286-100762308 AGCCCAGTGAAACCCCGGTGTGG - Intronic
1073190733 10:101649076-101649098 AGCCCAGGGAATCCCCAAAGAGG + Intronic
1074118586 10:110476455-110476477 AGCCCAGAGAAAACCCAATTAGG - Intergenic
1075618915 10:123911379-123911401 AGAGCAGGGCAGCCCCAAGGGGG + Intronic
1075716487 10:124558653-124558675 CCCCCATGGCACCCCCAATGTGG + Intronic
1076275254 10:129192996-129193018 GGCACAGGGCAGCCCCAATGTGG + Intergenic
1078672042 11:13374377-13374399 AGCACAGGGCAACTACAAGGGGG - Intronic
1079356865 11:19737061-19737083 AGCCCAAGGCAACACCACTGGGG + Intronic
1080760020 11:35239916-35239938 AACCCAGGGGAAACCCAGTGTGG + Intergenic
1081498784 11:43644635-43644657 AGCCCAGTCCAACCCCAAATAGG - Intronic
1083715128 11:64570991-64571013 AGCCCAGGGCAACCGGCAAGAGG + Exonic
1084219489 11:67668363-67668385 GGCCCAAGGGAACCCCAGTGGGG + Intronic
1084467752 11:69336262-69336284 AGCCCTGGCCAAGCCCACTGAGG + Intronic
1084876898 11:72139741-72139763 AGCCCAGGGCAACCCCAATGAGG + Exonic
1084879431 11:72159613-72159635 GGCCCAGGGCAACCCCAATGAGG + Intergenic
1084881963 11:72177881-72177903 AGCCCAGGGCAACCCCAGTGAGG + Intergenic
1084884700 11:72196051-72196073 AGCCCAGGGCAACCCCAATGAGG + Exonic
1084887674 11:72221624-72221646 AGCCCAGGGCAACCCCAACGAGG + Exonic
1087094705 11:94307578-94307600 TGCTCAGGGCAACCCCAATGTGG + Intronic
1089334142 11:117711197-117711219 AGCCCAGGGCAAAGCAAATGAGG + Intronic
1089489299 11:118871861-118871883 AGGACAGTGCACCCCCAATGGGG + Intergenic
1096472876 12:51890017-51890039 AGCAGAGGGCAGCCCCACTGCGG - Intronic
1101411143 12:104469591-104469613 AGCACAGAACAAGCCCAATGTGG - Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1103856270 12:123972979-123973001 TACCCAGGGCAACCGCAGTGCGG - Intronic
1105206838 13:18232711-18232733 TGCCCAGGGCATCGCTAATGAGG + Intergenic
1105207305 13:18234922-18234944 CGCCCAGGGCATCACTAATGAGG + Intergenic
1105207434 13:18235537-18235559 CGCCCAGGGCATCGCCAACGAGG + Exonic
1105207450 13:18235642-18235664 TGCCCAGGGCATCGCTAATGAGG + Exonic
1105207483 13:18235774-18235796 TGCCCAGGGCATCGCCAATGGGG + Exonic
1105207490 13:18235801-18235823 CGCACAGGGCATCGCCAATGAGG + Exonic
1105207518 13:18235909-18235931 CGCCCAGGGCATCGCCAACGGGG + Exonic
1105207542 13:18236017-18236039 CGCCCAGGGCATCGCCAACGAGG + Exonic
1105207568 13:18236122-18236144 CGCCCAGGGCATCGCCAACGAGG + Exonic
1105207585 13:18236200-18236222 CGCCCAGGGCATCGCCAACGAGG + Exonic
1106575553 13:30971043-30971065 AGCCCAAGGCAGCCCCAAAGAGG - Intronic
1110164813 13:72428383-72428405 AGCACAGGGCAATCCCATTGTGG - Intergenic
1112217507 13:97448677-97448699 AGTCCAGGCCAACCACAATTTGG - Intronic
1115336401 14:32247475-32247497 TCCCCAGGTCAACCCCAATTGGG - Intergenic
1115956996 14:38792372-38792394 TCCACAGGGCAACCCCAAGGAGG + Intergenic
1117099867 14:52335134-52335156 AGGCCAGGGCCATGCCAATGGGG - Intergenic
1121113627 14:91329018-91329040 GGCCCAGGGCATCCTCAGTGGGG + Intronic
1121251765 14:92505061-92505083 AGCCCAGGGAAACCCAATTTTGG + Intergenic
1121442888 14:93959820-93959842 AGCCCAGGTCAGCCCCAGGGAGG + Intronic
1202902193 14_GL000194v1_random:50387-50409 AGCCGAGGGCGACCCCAACACGG + Intergenic
1128511386 15:68315948-68315970 AGCCCCGAGAAACCCCATTGTGG - Intronic
1128785047 15:70389065-70389087 AGGCCAGGGGTACCCCAGTGAGG + Intergenic
1133076849 16:3286396-3286418 AGGGCAGAGCAAACCCAATGCGG + Intronic
1136394888 16:29987383-29987405 GGCCCAGGGGAACACCCATGAGG - Exonic
1137231209 16:46569405-46569427 CGCCCGGGGAAACCCCCATGAGG + Intergenic
1137938284 16:52656520-52656542 AGCCCAGGGAGACTCCACTGTGG + Intergenic
1138003662 16:53309558-53309580 AGCACAGGGCACCACCAATTAGG - Intronic
1139641038 16:68291599-68291621 AGGACAGGGCAACAGCAATGGGG - Exonic
1142053978 16:87980409-87980431 AGCTCAGGGCAGCCACAGTGTGG - Intronic
1147370511 17:39989436-39989458 AGGCCAGGGGAACTGCAATGGGG - Intronic
1148751376 17:49947518-49947540 AGCCCCTGGCGACCCCAGTGGGG - Intergenic
1151444912 17:74157077-74157099 AGCCAAGAGCAATGCCAATGGGG + Intergenic
1152285712 17:79411525-79411547 GGGCCAGGGCAGCCCCAAGGAGG - Intronic
1155185448 18:23383293-23383315 AGCCCAGGGAAACCCTGAAGAGG + Intronic
1158087807 18:53673805-53673827 AGCCCAGGCTAAACCCAAAGTGG - Intergenic
1160774411 19:848426-848448 TGCCCAGGGCCACCCTGATGGGG - Intergenic
1161282230 19:3452286-3452308 CTCCCACGGCAACCCCACTGGGG - Intronic
1161964718 19:7541622-7541644 AGCCCAGGGAGACCCCAGGGCGG + Exonic
1162079702 19:8210586-8210608 AGGCCAGGGTGACCCCACTGGGG + Intronic
1162566224 19:11446932-11446954 AGGCCAGGGCCACGCCAGTGAGG - Intronic
1162908471 19:13836958-13836980 AGCCCTGGGCAGGCCAAATGGGG + Intergenic
1163390777 19:17028512-17028534 AGACCAGGCCAACCCCAAACAGG + Intergenic
1166122633 19:40694550-40694572 AGGCCAGGGCTACCCGTATGGGG - Intronic
1167669425 19:50841275-50841297 AGCCCAGTGGTTCCCCAATGGGG - Intergenic
925915348 2:8600581-8600603 AGCCGAGGGCACCCCCTCTGAGG + Intergenic
926607730 2:14914346-14914368 TCCCAAGGGCAACCCCCATGTGG - Intergenic
927173718 2:20391029-20391051 GGCACAGAGCAACCCCCATGGGG - Intergenic
927844990 2:26466848-26466870 AGCCCTGGGCAAGACAAATGTGG + Exonic
929552604 2:42903978-42904000 ACCCCAGGGGAGCCCCCATGGGG - Intergenic
940863257 2:158791587-158791609 AGCACAGGGCAGCCCCAAAGTGG - Intergenic
941806225 2:169714059-169714081 AGCTCAGGGCAACACGGATGAGG - Intronic
946828622 2:223705109-223705131 ACACCAGGACAACCCCCATGAGG + Intergenic
947526561 2:230880243-230880265 AGCCCAGTGCAACCCAACAGAGG + Intergenic
948625339 2:239264996-239265018 AGAGCAGGGCAGGCCCAATGCGG + Intronic
1174382261 20:50163670-50163692 AGCCCAGGGGAAGCCCACAGAGG - Intergenic
1175766585 20:61596752-61596774 AGTCCAGGGCAGCCCCACGGAGG - Intronic
1176296748 21:5077019-5077041 AGCCCCGGGAAACCCCATGGGGG - Intergenic
1176621561 21:9065154-9065176 AGCCGAGGGCGACCCCAACACGG + Intergenic
1177594752 21:23224143-23224165 ATCCCAAGGCAGCCCCAAGGTGG + Intergenic
1179860301 21:44185102-44185124 AGCCCCGGGAAACCCCATGGGGG + Intergenic
1180759116 22:18186071-18186093 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180759131 22:18186125-18186147 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180759139 22:18186152-18186174 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180759146 22:18186179-18186201 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180759153 22:18186206-18186228 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180759166 22:18186260-18186282 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180769446 22:18370459-18370481 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180769454 22:18370486-18370508 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180769461 22:18370513-18370535 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180769474 22:18370567-18370589 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180776855 22:18492110-18492132 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180776868 22:18492164-18492186 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180776875 22:18492191-18492213 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180776882 22:18492218-18492240 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180809578 22:18749449-18749471 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180809585 22:18749476-18749498 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180809598 22:18749530-18749552 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180809605 22:18749557-18749579 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180809612 22:18749584-18749606 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180827248 22:18872871-18872893 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1180827255 22:18872898-18872920 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180827262 22:18872925-18872947 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180827288 22:18873033-18873055 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180827295 22:18873060-18873082 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180827302 22:18873087-18873109 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1180827310 22:18873114-18873136 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180827317 22:18873141-18873163 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180827325 22:18873168-18873190 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180827333 22:18873195-18873217 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180827365 22:18873330-18873352 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180827374 22:18873357-18873379 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180827382 22:18873384-18873406 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1181195596 22:21183503-21183525 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195614 22:21183584-21183606 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195621 22:21183611-21183633 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195629 22:21183638-21183660 CGCCCAGGGCATCGCCAAGGAGG + Intergenic
1181195636 22:21183665-21183687 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195644 22:21183692-21183714 CGCCCAGGGCATCGCCAAAGAGG + Intergenic
1181195687 22:21183881-21183903 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195705 22:21183962-21183984 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195712 22:21183989-21184011 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195720 22:21184016-21184038 CGCCCAGGGCATCGCCAAGGAGG + Intergenic
1181195728 22:21184043-21184065 CGCCCAGGGCATCGCCAAGGAGG + Intergenic
1181195735 22:21184070-21184092 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195743 22:21184097-21184119 CGCCCAGGGCATCGCCAAAGAGG + Intergenic
1181195756 22:21184151-21184173 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195781 22:21184259-21184281 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195788 22:21184286-21184308 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195795 22:21184313-21184335 CGCCCAGGGCATCGCCAAAGAGG + Intergenic
1181213734 22:21308811-21308833 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1181213741 22:21308838-21308860 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213748 22:21308865-21308887 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213774 22:21308973-21308995 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213787 22:21309027-21309049 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1181213795 22:21309054-21309076 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213802 22:21309081-21309103 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1181213810 22:21309108-21309130 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1181213817 22:21309135-21309157 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213824 22:21309162-21309184 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1181213832 22:21309189-21309211 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213844 22:21309243-21309265 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1181213852 22:21309270-21309292 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1182269566 22:29144979-29145001 AGCCCCGGGAAACCCAAATCTGG + Intronic
1182621179 22:31619620-31619642 AGCCCAGGGCTTCCCCAAAGCGG + Exonic
1183061297 22:35337908-35337930 TGCCCTGGGCACCCCCACTGCGG + Intronic
1183123410 22:35750664-35750686 AGCACTGGGCAGCCCCACTGGGG - Intronic
1183739292 22:39661232-39661254 AGCCCAGGGCCACCAGCATGGGG - Exonic
1184099444 22:42334338-42334360 GTCCCAGGGGTACCCCAATGAGG + Intronic
1184390880 22:44202398-44202420 AGCCCAGGGGCACCCCAGAGTGG - Intronic
1184514728 22:44955026-44955048 AGCCCAGAGCAACCACACTAGGG + Intronic
1184821313 22:46910935-46910957 AGCTCAGTGCAGCCACAATGTGG + Intronic
1185142030 22:49107905-49107927 AGCCCAGGACAAGCCGAGTGAGG - Intergenic
1203231006 22_KI270731v1_random:110528-110550 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1203231013 22_KI270731v1_random:110555-110577 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231020 22_KI270731v1_random:110582-110604 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231039 22_KI270731v1_random:110663-110685 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231052 22_KI270731v1_random:110717-110739 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1203231059 22_KI270731v1_random:110744-110766 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231066 22_KI270731v1_random:110771-110793 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231074 22_KI270731v1_random:110798-110820 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231082 22_KI270731v1_random:110825-110847 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231101 22_KI270731v1_random:110906-110928 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231108 22_KI270731v1_random:110933-110955 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231115 22_KI270731v1_random:110960-110982 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231136 22_KI270731v1_random:111041-111063 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231149 22_KI270731v1_random:111095-111117 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231156 22_KI270731v1_random:111122-111144 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231164 22_KI270731v1_random:111149-111171 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231172 22_KI270731v1_random:111176-111198 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1203231179 22_KI270731v1_random:111203-111225 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231236 22_KI270731v1_random:111446-111468 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231244 22_KI270731v1_random:111473-111495 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1203231251 22_KI270731v1_random:111500-111522 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231258 22_KI270731v1_random:111527-111549 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231266 22_KI270731v1_random:111554-111576 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231285 22_KI270731v1_random:111635-111657 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277431 22_KI270734v1_random:99212-99234 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277438 22_KI270734v1_random:99239-99261 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277457 22_KI270734v1_random:99320-99342 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277464 22_KI270734v1_random:99347-99369 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277471 22_KI270734v1_random:99374-99396 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277478 22_KI270734v1_random:99401-99423 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277485 22_KI270734v1_random:99428-99450 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277492 22_KI270734v1_random:99455-99477 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277512 22_KI270734v1_random:99536-99558 CGCCCAGGGCATCGCCAACGAGG - Intergenic
954420322 3:50415551-50415573 AGCCCATGGTAACCCCAAGGAGG - Intronic
956790902 3:72679293-72679315 AGCCCTGGGGAAACACAATGTGG + Intergenic
957127754 3:76184292-76184314 AGCCCAGGGCAACCCACTGGAGG - Intronic
959880542 3:111440193-111440215 AGTCAAGGGCAACCCCACTATGG + Intronic
961382265 3:126503574-126503596 AGCGCAGGGCAGCCCCTATCAGG + Intronic
961455780 3:127023196-127023218 AGCACAGGGGAAGCCCAGTGCGG - Intronic
963104367 3:141633417-141633439 AGCCCAGGGCAACCAATGTGAGG - Intergenic
966338854 3:178902708-178902730 AGCACAAGTCGACCCCAATGTGG + Intergenic
968699280 4:2047081-2047103 AGCCCAGGGGAACCCCAGGACGG - Intergenic
971227526 4:24768887-24768909 AGCCCAGCCCAGCCCCAAAGTGG + Intergenic
974868402 4:67608163-67608185 AGCCCAGGGCCTTGCCAATGTGG + Intergenic
977235041 4:94498074-94498096 AGCCCAGGTCAATCCTCATGTGG - Intronic
980158484 4:129133624-129133646 AGCCAAGGACCAGCCCAATGAGG + Intergenic
981589074 4:146337060-146337082 AGCCCAGGGCAACAGAGATGTGG + Intronic
983313605 4:166097814-166097836 ATCCCAGGGGAAATCCAATGTGG - Intronic
984937184 4:184899584-184899606 TGCCCAGGCCAACACCAACGTGG + Intergenic
985401789 4:189600508-189600530 AGCGCAGGGCAGCACCACTGTGG + Intergenic
985838320 5:2287357-2287379 ACAACAGGTCAACCCCAATGGGG + Intergenic
992615643 5:78543635-78543657 AGCCCAGGGCAGCCCCACTAGGG + Intronic
997460862 5:134051316-134051338 AGCCCAGGCCTAGCCCACTGTGG - Intergenic
998174956 5:139895991-139896013 AGCACAGGCCCACCCCAAAGAGG - Intronic
1001951719 5:175821028-175821050 ATCCCAGGACAACCCCCAGGAGG - Intronic
1003950131 6:11109045-11109067 TCCCCAGGTCAACCCCAATTGGG - Intronic
1007473360 6:42104670-42104692 GGCCCAGGGCTACCCCACGGTGG - Exonic
1013597317 6:111672022-111672044 AGCTCACGACACCCCCAATGAGG + Intronic
1015204536 6:130619837-130619859 AGCCCAAGGCAACTGGAATGAGG - Intergenic
1018631957 6:165829235-165829257 TGCCCAGGGCAGCTCCACTGGGG - Intronic
1019397826 7:832249-832271 AGACCAGGGGAACCCTAAAGTGG - Intronic
1019778563 7:2926577-2926599 AGCCATGGGCAAGCCCAATGGGG + Intronic
1020131265 7:5559831-5559853 ACCCCAGAGCCACCCCGATGTGG - Intronic
1020746988 7:12090945-12090967 AGCCCAGGGCCCCCCCACAGTGG + Intergenic
1022785882 7:33636147-33636169 AGCCAAGGGCAACAGCAAGGAGG + Intergenic
1026925585 7:74190590-74190612 AGCCCAGGGAAACTCCTCTGTGG + Intronic
1030551226 7:110962643-110962665 ATCCCAGGGGATCCCCACTGGGG - Intronic
1033710313 7:143935964-143935986 AGCACAGGGCAACCACCGTGAGG - Exonic
1033712335 7:143960702-143960724 AGCACAGGGCAACCACTGTGAGG - Exonic
1033964339 7:146956469-146956491 AGCCCAGCTGAAACCCAATGTGG - Intronic
1036390958 8:8324081-8324103 AGCCCAGGGCAAGCACAATGGGG + Intronic
1041450119 8:57996652-57996674 AGCCCAGGTCTTCCCTAATGTGG - Intronic
1041539593 8:58967795-58967817 AGCCCAGGGAAACCAGAGTGAGG - Intronic
1042289559 8:67155116-67155138 AGCCCAGGGTACCCCCAGTATGG - Intronic
1042844669 8:73158281-73158303 AGCGAAGGGCAACACCACTGGGG - Intergenic
1046055267 8:109071240-109071262 AGCCCAGGCCAGCCCCAGAGAGG + Intergenic
1047006273 8:120623543-120623565 TCCCTAGTGCAACCCCAATGTGG + Intronic
1047513729 8:125535552-125535574 GGCCCAGGGCAAGCCCATTAAGG + Intergenic
1049311670 8:141936875-141936897 AGCCCAGGTCACCCCGAATGGGG - Intergenic
1049374285 8:142281676-142281698 AGCCAAGGGCAACCCCATAGAGG + Intronic
1049718834 8:144106291-144106313 AGCCCAGGGCTACCCAAAGTGGG - Intronic
1050652658 9:7790517-7790539 AGCCCAGGGACCCCCCAAAGTGG - Intergenic
1051852712 9:21528107-21528129 AGCAGAGTGCAACCCCACTGCGG + Intergenic
1051889031 9:21924618-21924640 AGCCCTGGGTAAACCCAATGAGG - Intronic
1058939144 9:109797255-109797277 AGCTCAGGGTAACCCCAAGCTGG - Intronic
1060401920 9:123354399-123354421 AGACCCAGGCAATCCCAATGGGG - Intergenic
1062450075 9:136611479-136611501 TGCCCAGGGCAGGCCCAGTGTGG + Intergenic
1062459302 9:136656258-136656280 AGCCCAGGGCCACCTGCATGGGG + Intergenic
1203744746 Un_GL000218v1:35564-35586 AGCCGAGGGCGACCCCAACACGG + Intergenic
1186723913 X:12336362-12336384 AGCCCAGGGCTACCAAGATGAGG - Intronic
1187107862 X:16262578-16262600 AACCCAAGGAAACCCCAATTAGG - Intergenic
1187757987 X:22547158-22547180 TGCCCAGGGCACCCTCAATAAGG - Intergenic
1189086814 X:38034082-38034104 GGCCAAGTGCAACCACAATGGGG + Intronic
1189513207 X:41684385-41684407 AACCCTGGGCAAACCCAAAGAGG + Intronic
1193883833 X:86960536-86960558 AGCCCATGGCCACCCCCATATGG - Intergenic
1195900642 X:109794078-109794100 AGCCCTGGGCAACCACCATTAGG - Intergenic
1200251916 X:154558441-154558463 AGCCCGGGGCAACCCGCAAGCGG - Intronic
1200265851 X:154645975-154645997 AGCCCGGGGCAACCCGCAAGCGG + Intergenic
1201158084 Y:11150607-11150629 AGCCGAGGGCGACCCCAACACGG + Intergenic