ID: 1084878124

View in Genome Browser
Species Human (GRCh38)
Location 11:72149122-72149144
Sequence TGGGACTCCTTGGGGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084878117_1084878124 29 Left 1084878117 11:72149070-72149092 CCATGGTTTAAAGTCAGCTTAAT No data
Right 1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084878124 Original CRISPR TGGGACTCCTTGGGGAAAAC AGG Intergenic
No off target data available for this crispr