ID: 1084879431

View in Genome Browser
Species Human (GRCh38)
Location 11:72159613-72159635
Sequence GGCCCAGGGCAACCCCAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 2, 2: 4, 3: 12, 4: 272}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084879427_1084879431 -5 Left 1084879427 11:72159595-72159617 CCAGATGTGGTTCGACCTGGCCC 0: 1
1: 0
2: 1
3: 3
4: 44
Right 1084879431 11:72159613-72159635 GGCCCAGGGCAACCCCAATGAGG 0: 1
1: 2
2: 4
3: 12
4: 272
1084879423_1084879431 16 Left 1084879423 11:72159574-72159596 CCGAGGGAGCAGCCGCTGCATCC 0: 1
1: 1
2: 4
3: 22
4: 211
Right 1084879431 11:72159613-72159635 GGCCCAGGGCAACCCCAATGAGG 0: 1
1: 2
2: 4
3: 12
4: 272
1084879425_1084879431 4 Left 1084879425 11:72159586-72159608 CCGCTGCATCCAGATGTGGTTCG No data
Right 1084879431 11:72159613-72159635 GGCCCAGGGCAACCCCAATGAGG 0: 1
1: 2
2: 4
3: 12
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084879431 Original CRISPR GGCCCAGGGCAACCCCAATG AGG Intergenic
900292605 1:1929852-1929874 GGCCCAAGGCCACCCCCATCGGG - Intronic
900412195 1:2517666-2517688 AGGCCAGGGCAAACCCACTGGGG + Intronic
900590649 1:3457985-3458007 GGGCCAGGGCAGCCCCATAGAGG - Intronic
901185880 1:7372919-7372941 GGCCCAGGGCCACTTCAATGGGG - Intronic
901317629 1:8319319-8319341 GGCCCAAGGCAACCCCGTGGGGG + Intronic
901784665 1:11616839-11616861 GGCCCAGGGTCACACCATTGAGG + Intergenic
903673014 1:25047577-25047599 GGTCCAGGGAAACCTCAAAGAGG - Intergenic
904378267 1:30095233-30095255 GGCCCTGGGCCAGCCCAAGGGGG - Intergenic
905369415 1:37475060-37475082 GGCCCAAGGCTTCCCCACTGAGG - Intronic
906165185 1:43680779-43680801 GGCCCAATGTAATCCCAATGGGG - Intronic
906747161 1:48230168-48230190 GGCCCACGGCTGACCCAATGCGG - Intronic
907456790 1:54581409-54581431 GGCCCAGGGCCACCCAGCTGCGG - Intronic
908751669 1:67430105-67430127 GGCCCAGACCAACTCCAACGCGG - Exonic
911964839 1:104353503-104353525 GGCCCAGGATAACCAAAATGTGG - Intergenic
912382014 1:109252881-109252903 GGGCCACGGCTAGCCCAATGGGG - Exonic
913685730 1:121230254-121230276 GACCCAGGGCAACAGCAGTGAGG - Intronic
914037578 1:144017857-144017879 GACCCAGGGCAACAGCAGTGAGG - Intergenic
914151876 1:145050075-145050097 GACCCAGGGCAACAGCAGTGAGG + Intronic
920100649 1:203515132-203515154 GGCCAATGGCAGCACCAATGTGG + Intergenic
920383756 1:205552369-205552391 GCCCCAGGCCAACACCTATGTGG + Intergenic
920473051 1:206248811-206248833 GACCCAGGGCAACAGCAGTGAGG - Intronic
921295266 1:213695410-213695432 GGTGGAGGGCAACCCCACTGAGG + Intergenic
1062944915 10:1452968-1452990 GGCCCGGCCCAACCCCACTGAGG - Intronic
1063888384 10:10602975-10602997 GGCCCAGGGAAAGCACAAAGAGG + Intergenic
1065965564 10:30767820-30767842 GCCCCGGGGCAACCTCCATGTGG + Intergenic
1069601208 10:69709419-69709441 GGCCCAGGGTCACTCTAATGGGG + Intergenic
1070890830 10:79941358-79941380 GGCCCAGGGAAGCCCCGCTGGGG - Intronic
1071456820 10:85857444-85857466 GGCCCAGCGGGAGCCCAATGGGG + Intronic
1073190733 10:101649076-101649098 AGCCCAGGGAATCCCCAAAGAGG + Intronic
1073212102 10:101812695-101812717 GGCCCAGGGCAAGGCAAGTGAGG - Intronic
1073777014 10:106797812-106797834 GGAGCAGGGCAACCCCAGAGTGG + Intronic
1075007259 10:118839940-118839962 GTCCCAGGGAAAACCCAGTGGGG + Intergenic
1075716487 10:124558653-124558675 CCCCCATGGCACCCCCAATGTGG + Intronic
1076275254 10:129192996-129193018 GGCACAGGGCAGCCCCAATGTGG + Intergenic
1076313043 10:129521751-129521773 GGCCCAGGGCAAGTCCCACGAGG + Intronic
1077216771 11:1398310-1398332 GGCCCAGGCCAGCCCCAACCAGG - Intronic
1077327842 11:1971383-1971405 GGCCCGGGGCAGCCGCAAAGTGG - Intronic
1079356865 11:19737061-19737083 AGCCCAAGGCAACACCACTGGGG + Intronic
1083332014 11:61903119-61903141 GGCCCTGAGCAACCCCCATCTGG + Intronic
1084219489 11:67668363-67668385 GGCCCAAGGGAACCCCAGTGGGG + Intronic
1084876898 11:72139741-72139763 AGCCCAGGGCAACCCCAATGAGG + Exonic
1084879431 11:72159613-72159635 GGCCCAGGGCAACCCCAATGAGG + Intergenic
1084881963 11:72177881-72177903 AGCCCAGGGCAACCCCAGTGAGG + Intergenic
1084884700 11:72196051-72196073 AGCCCAGGGCAACCCCAATGAGG + Exonic
1084887674 11:72221624-72221646 AGCCCAGGGCAACCCCAACGAGG + Exonic
1085800031 11:79580792-79580814 GGCACAGGGCATCCCATATGAGG - Intergenic
1087094705 11:94307578-94307600 TGCTCAGGGCAACCCCAATGTGG + Intronic
1087874456 11:103339320-103339342 GGCCCATGGCCACCACCATGTGG + Intronic
1088441667 11:109877729-109877751 GGCCAAGCCCAACACCAATGGGG - Intergenic
1089334142 11:117711197-117711219 AGCCCAGGGCAAAGCAAATGAGG + Intronic
1202810822 11_KI270721v1_random:26563-26585 GGCCCGGGGCAGCCGCAAAGTGG - Intergenic
1095982933 12:47983041-47983063 GACCCAGGGCAGGCCCAAGGAGG + Intronic
1101302509 12:103496015-103496037 GTCGCCGGGCAACCACAATGGGG + Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102617466 12:114167053-114167075 GGCCCAAGGCATACCCTATGTGG + Intergenic
1103520152 12:121532719-121532741 GGCCCAGAGCAACCCTCAGGGGG + Intronic
1103732431 12:123036793-123036815 GGCCTGGGGCCACCCCAAGGAGG - Intronic
1103856270 12:123972979-123973001 TACCCAGGGCAACCGCAGTGCGG - Intronic
1105206838 13:18232711-18232733 TGCCCAGGGCATCGCTAATGAGG + Intergenic
1105207305 13:18234922-18234944 CGCCCAGGGCATCACTAATGAGG + Intergenic
1105207434 13:18235537-18235559 CGCCCAGGGCATCGCCAACGAGG + Exonic
1105207450 13:18235642-18235664 TGCCCAGGGCATCGCTAATGAGG + Exonic
1105207483 13:18235774-18235796 TGCCCAGGGCATCGCCAATGGGG + Exonic
1105207490 13:18235801-18235823 CGCACAGGGCATCGCCAATGAGG + Exonic
1105207518 13:18235909-18235931 CGCCCAGGGCATCGCCAACGGGG + Exonic
1105207542 13:18236017-18236039 CGCCCAGGGCATCGCCAACGAGG + Exonic
1105207568 13:18236122-18236144 CGCCCAGGGCATCGCCAACGAGG + Exonic
1105207585 13:18236200-18236222 CGCCCAGGGCATCGCCAACGAGG + Exonic
1106575553 13:30971043-30971065 AGCCCAAGGCAGCCCCAAAGAGG - Intronic
1108476480 13:50823704-50823726 GGCCCAGGCCAATCACAGTGTGG + Intronic
1110164813 13:72428383-72428405 AGCACAGGGCAATCCCATTGTGG - Intergenic
1115336401 14:32247475-32247497 TCCCCAGGTCAACCCCAATTGGG - Intergenic
1115956996 14:38792372-38792394 TCCACAGGGCAACCCCAAGGAGG + Intergenic
1117088465 14:52225342-52225364 GGCCCAGGGCAACACTTGTGCGG + Intergenic
1119425417 14:74531767-74531789 GGCCCAGGGAAAGCCCTATCTGG + Intronic
1121113627 14:91329018-91329040 GGCCCAGGGCATCCTCAGTGGGG + Intronic
1122920052 14:104876324-104876346 GGACCTGGGCAGCCTCAATGGGG + Exonic
1123034861 14:105467731-105467753 GGCCCAGGGCCAGCCCACTCTGG + Intronic
1125676378 15:41504509-41504531 GGCCCTGGGCAGCCCCTAGGAGG + Exonic
1125790222 15:42359883-42359905 GGCCCAGAGCAAGGCCACTGAGG + Exonic
1127959007 15:63877100-63877122 GGCCAAGCCCAACACCAATGGGG - Intergenic
1128543800 15:68554357-68554379 GGCCCAAGCAAACCCCAAAGAGG + Intergenic
1128592126 15:68908611-68908633 GGCTCAGGGAAAGCCCAGTGAGG + Intronic
1128689094 15:69709751-69709773 GGGCCTGGGCAACCCCACAGTGG - Intergenic
1132118427 15:99156168-99156190 GGCGCAGGGGAACCACAGTGGGG - Exonic
1132697681 16:1209228-1209250 GGCCCCGTGCCACCCCACTGCGG + Exonic
1132904960 16:2277835-2277857 GGCCCAGGGCCCACCCAGTGGGG + Intronic
1132906529 16:2285381-2285403 GTCCCAGGGCAAGCCCTCTGCGG + Intronic
1132925026 16:2424789-2424811 GGCCCAGGGCCCACCCAGTGGGG - Intergenic
1134608066 16:15586831-15586853 GGCCCAGGGCACCCCACGTGGGG - Exonic
1134773917 16:16835390-16835412 GGCCAAGGGCCACCCAAATTAGG - Intergenic
1136394888 16:29987383-29987405 GGCCCAGGGGAACACCCATGAGG - Exonic
1136411302 16:30078978-30079000 GTGCCAGCGCAACCCCAGTGTGG - Intronic
1137231209 16:46569405-46569427 CGCCCGGGGAAACCCCCATGAGG + Intergenic
1139761322 16:69186977-69186999 GGACGTGGGCAACCCGAATGCGG - Intronic
1140519092 16:75566579-75566601 GGCCCAGGGCCGCCCGAGTGGGG - Intronic
1141479902 16:84299647-84299669 GGCCCATGGCAGCCACCATGCGG + Intronic
1143893717 17:10120941-10120963 GGCCCACTGGAACCCCAAGGTGG + Intronic
1145798684 17:27670230-27670252 GCCACAGGACAACCCCAGTGAGG + Intergenic
1148684683 17:49495011-49495033 GGACCAGGGCGTCCCCACTGCGG - Intergenic
1148834938 17:50461089-50461111 GCCCCAGGGCAGACCCACTGAGG + Intronic
1152285712 17:79411525-79411547 GGGCCAGGGCAGCCCCAAGGAGG - Intronic
1152561145 17:81079366-81079388 GGCCCACGGTGACCCCAGTGTGG + Intronic
1152740025 17:82014742-82014764 GGCCCACGTCAACCCCCACGGGG - Intronic
1156250159 18:35344560-35344582 GGCCAAGCGCAGCCTCAATGCGG - Intronic
1157145959 18:45162788-45162810 GGATCAGGGCAACTGCAATGAGG + Intergenic
1160774411 19:848426-848448 TGCCCAGGGCCACCCTGATGGGG - Intergenic
1161282230 19:3452286-3452308 CTCCCACGGCAACCCCACTGGGG - Intronic
1161968268 19:7561117-7561139 GGCCCAGGGGACCCCCCAAGAGG + Intronic
1166577445 19:43855656-43855678 GGCCAAGCCCAACACCAATGGGG + Intergenic
1166939321 19:46353314-46353336 GGCCCCGGGCAGCCACAGTGAGG - Intronic
1168694492 19:58396844-58396866 GGCCCAGGGCGACCCCGGCGGGG - Exonic
925724726 2:6861864-6861886 GGCCAAGGCCAAGCCCAAAGGGG - Intronic
926607730 2:14914346-14914368 TCCCAAGGGCAACCCCCATGTGG - Intergenic
927173718 2:20391029-20391051 GGCACAGAGCAACCCCCATGGGG - Intergenic
927811386 2:26182432-26182454 GGCCCAGTGCCACCTCCATGCGG + Intronic
930206095 2:48587834-48587856 GGCCCAGGGAAAACACAGTGGGG + Intronic
932495590 2:72144427-72144449 GGCCCAGGGGCACCCCCAGGAGG + Intronic
934088360 2:88529285-88529307 GGCCCAGGGTGACCCCAACCAGG + Exonic
935712790 2:105913960-105913982 GGCCCAGGGAGAGGCCAATGAGG + Intergenic
936058344 2:109278342-109278364 GGCCCAGGGGCATCCCAGTGGGG + Intronic
940863257 2:158791587-158791609 AGCACAGGGCAGCCCCAAAGTGG - Intergenic
946840377 2:223813845-223813867 GTCACAGAGAAACCCCAATGAGG + Intronic
948613737 2:239185214-239185236 GATACAGGGCAACCCCCATGGGG - Intronic
1171286817 20:23946426-23946448 GGCCCAGAGTGACCACAATGTGG + Intergenic
1175466279 20:59192738-59192760 GCACCAGGGCATCGCCAATGGGG - Exonic
1176188425 20:63794645-63794667 GGGCCACGTCAACCCCACTGTGG + Intronic
1180759116 22:18186071-18186093 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180759131 22:18186125-18186147 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180759139 22:18186152-18186174 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180759146 22:18186179-18186201 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180759153 22:18186206-18186228 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180759166 22:18186260-18186282 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180769446 22:18370459-18370481 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180769454 22:18370486-18370508 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180769461 22:18370513-18370535 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180769474 22:18370567-18370589 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180776855 22:18492110-18492132 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180776868 22:18492164-18492186 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180776875 22:18492191-18492213 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180776882 22:18492218-18492240 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180809578 22:18749449-18749471 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180809585 22:18749476-18749498 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180809598 22:18749530-18749552 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180809605 22:18749557-18749579 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180809612 22:18749584-18749606 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180827248 22:18872871-18872893 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1180827255 22:18872898-18872920 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180827262 22:18872925-18872947 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180827288 22:18873033-18873055 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180827295 22:18873060-18873082 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180827302 22:18873087-18873109 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1180827310 22:18873114-18873136 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180827317 22:18873141-18873163 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180827325 22:18873168-18873190 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180827333 22:18873195-18873217 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180827365 22:18873330-18873352 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180827374 22:18873357-18873379 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180827382 22:18873384-18873406 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1181162816 22:20967867-20967889 GGCCTAGGGCGCCCCCCATGGGG - Exonic
1181195596 22:21183503-21183525 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195614 22:21183584-21183606 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195621 22:21183611-21183633 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195629 22:21183638-21183660 CGCCCAGGGCATCGCCAAGGAGG + Intergenic
1181195636 22:21183665-21183687 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195644 22:21183692-21183714 CGCCCAGGGCATCGCCAAAGAGG + Intergenic
1181195687 22:21183881-21183903 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195705 22:21183962-21183984 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195712 22:21183989-21184011 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195720 22:21184016-21184038 CGCCCAGGGCATCGCCAAGGAGG + Intergenic
1181195728 22:21184043-21184065 CGCCCAGGGCATCGCCAAGGAGG + Intergenic
1181195735 22:21184070-21184092 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195743 22:21184097-21184119 CGCCCAGGGCATCGCCAAAGAGG + Intergenic
1181195756 22:21184151-21184173 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195781 22:21184259-21184281 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195788 22:21184286-21184308 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195795 22:21184313-21184335 CGCCCAGGGCATCGCCAAAGAGG + Intergenic
1181213734 22:21308811-21308833 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1181213741 22:21308838-21308860 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213748 22:21308865-21308887 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213774 22:21308973-21308995 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213787 22:21309027-21309049 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1181213795 22:21309054-21309076 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213802 22:21309081-21309103 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1181213810 22:21309108-21309130 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1181213817 22:21309135-21309157 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213824 22:21309162-21309184 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1181213832 22:21309189-21309211 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213844 22:21309243-21309265 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1181213852 22:21309270-21309292 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1182621179 22:31619620-31619642 AGCCCAGGGCTTCCCCAAAGCGG + Exonic
1183061297 22:35337908-35337930 TGCCCTGGGCACCCCCACTGCGG + Intronic
1184099444 22:42334338-42334360 GTCCCAGGGGTACCCCAATGAGG + Intronic
1203231006 22_KI270731v1_random:110528-110550 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1203231013 22_KI270731v1_random:110555-110577 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231020 22_KI270731v1_random:110582-110604 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231039 22_KI270731v1_random:110663-110685 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231052 22_KI270731v1_random:110717-110739 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1203231059 22_KI270731v1_random:110744-110766 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231066 22_KI270731v1_random:110771-110793 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231074 22_KI270731v1_random:110798-110820 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231082 22_KI270731v1_random:110825-110847 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231101 22_KI270731v1_random:110906-110928 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231108 22_KI270731v1_random:110933-110955 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231115 22_KI270731v1_random:110960-110982 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231136 22_KI270731v1_random:111041-111063 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231149 22_KI270731v1_random:111095-111117 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231156 22_KI270731v1_random:111122-111144 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231164 22_KI270731v1_random:111149-111171 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231172 22_KI270731v1_random:111176-111198 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1203231179 22_KI270731v1_random:111203-111225 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231236 22_KI270731v1_random:111446-111468 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231244 22_KI270731v1_random:111473-111495 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1203231251 22_KI270731v1_random:111500-111522 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231258 22_KI270731v1_random:111527-111549 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231266 22_KI270731v1_random:111554-111576 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231285 22_KI270731v1_random:111635-111657 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277431 22_KI270734v1_random:99212-99234 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277438 22_KI270734v1_random:99239-99261 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277457 22_KI270734v1_random:99320-99342 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277464 22_KI270734v1_random:99347-99369 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277471 22_KI270734v1_random:99374-99396 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277478 22_KI270734v1_random:99401-99423 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277485 22_KI270734v1_random:99428-99450 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277492 22_KI270734v1_random:99455-99477 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277512 22_KI270734v1_random:99536-99558 CGCCCAGGGCATCGCCAACGAGG - Intergenic
952342889 3:32460067-32460089 GGCCTAGGACCACCCCACTGCGG + Intronic
954326454 3:49866795-49866817 GGCCCAGGGAAAGCCCAAACGGG + Intronic
954420322 3:50415551-50415573 AGCCCATGGTAACCCCAAGGAGG - Intronic
954609143 3:51935100-51935122 GCCTCAGGGCACCCCCAGTGGGG - Intronic
960258153 3:115533343-115533365 GGCCCTGGGCAAGCTCCATGGGG + Intergenic
968509927 4:991076-991098 GGCCCAGGGCACCCCCCCTTAGG - Intronic
968541227 4:1169404-1169426 GGCCCAGTTCATCCCAAATGAGG + Intronic
968570994 4:1340597-1340619 GGGCCAGGGCAGCCACCATGGGG - Intergenic
968799568 4:2733240-2733262 GGCCCAGGGCACCCCCACCCAGG + Intergenic
969600156 4:8171402-8171424 GGCCCAGGGCAACAGGAGTGGGG - Intergenic
970511803 4:16788574-16788596 GGTCCAGGGCATCCCCATAGGGG - Intronic
975812272 4:78181851-78181873 GGCCCAGACCAACTCCAACGCGG - Intronic
980907157 4:138959641-138959663 GGCACAGGGCAGCCTGAATGTGG - Intergenic
982139689 4:152305740-152305762 GGTCGAGGGCAACCTAAATGTGG + Intergenic
982598372 4:157414189-157414211 GGCCCAGGTGACCCCCAGTGTGG - Intergenic
984644558 4:182205563-182205585 GGCCCAGGGGAGCACCCATGAGG - Intronic
984937184 4:184899584-184899606 TGCCCAGGCCAACACCAACGTGG + Intergenic
985534253 5:454440-454462 GGCACATGGCCACCCCACTGGGG + Intronic
990284501 5:54287176-54287198 GGCCCAGAGCATCCTTAATGTGG + Intronic
992615643 5:78543635-78543657 AGCCCAGGGCAGCCCCACTAGGG + Intronic
999238851 5:150115794-150115816 GGCGCAGGGCACCCCGAATCCGG + Exonic
1003950131 6:11109045-11109067 TCCCCAGGTCAACCCCAATTGGG - Intronic
1005114357 6:22319065-22319087 GCCCCAGGGCATCCCCAAATTGG - Intergenic
1007473360 6:42104670-42104692 GGCCCAGGGCTACCCCACGGTGG - Exonic
1007633434 6:43285059-43285081 GGCCCAGGGCGAGCCCAAGCCGG + Exonic
1010144072 6:72645656-72645678 GGCCCAGCGCAAAGCCAGTGAGG - Intronic
1012487998 6:99743559-99743581 GACCCAGGGCCACTCTAATGAGG + Intergenic
1018631957 6:165829235-165829257 TGCCCAGGGCAGCTCCACTGGGG - Intronic
1019032457 6:169024654-169024676 GGCCCAGGCACACCCCGATGCGG - Intergenic
1019506682 7:1394965-1394987 GGCCCTGGGCAAGCCCCCTGTGG - Intergenic
1019778563 7:2926577-2926599 AGCCATGGGCAAGCCCAATGGGG + Intronic
1024539150 7:50461800-50461822 GACCCAGAGCAACTCCAAAGTGG - Intronic
1026657608 7:72270943-72270965 GACCCAAGGCAATACCAATGTGG + Intronic
1029270223 7:99373194-99373216 GGCTAAGGGCACCTCCAATGGGG + Intronic
1030597078 7:111552907-111552929 GTCCCACGGCAAGCCCATTGTGG + Intronic
1031142266 7:117956381-117956403 GGCCCAGGAGACCCCCAGTGGGG + Intergenic
1034163312 7:149007813-149007835 GGCCCAGGCCAAACCCACAGTGG + Intronic
1034901221 7:154909269-154909291 GGGCCAGGGCAGCCACCATGGGG - Intergenic
1035434551 7:158849863-158849885 GGCCAAGGGCAGCCCAAAAGAGG + Intergenic
1035627508 8:1082455-1082477 GAGCCACGGCACCCCCAATGTGG - Intergenic
1036390958 8:8324081-8324103 AGCCCAGGGCAAGCACAATGGGG + Intronic
1038036347 8:23689900-23689922 GGCCCAGAGCAAGACCAGTGGGG - Intergenic
1047006273 8:120623543-120623565 TCCCTAGTGCAACCCCAATGTGG + Intronic
1047513729 8:125535552-125535574 GGCCCAGGGCAAGCCCATTAAGG + Intergenic
1049311670 8:141936875-141936897 AGCCCAGGTCACCCCGAATGGGG - Intergenic
1049374285 8:142281676-142281698 AGCCAAGGGCAACCCCATAGAGG + Intronic
1049478983 8:142811059-142811081 GGCCCTGGGCAGCCTCAAGGAGG - Intergenic
1049913129 9:289501-289523 GGTCCAGTTCAACCCTAATGAGG - Exonic
1051889031 9:21924618-21924640 AGCCCTGGGTAAACCCAATGAGG - Intronic
1054761572 9:69009509-69009531 GGTCCAGAGCAGCCCCTATGTGG + Intergenic
1059157682 9:112004524-112004546 GGCCCAGGGCCCCCCCAAGTGGG - Intergenic
1059311410 9:113391125-113391147 GCCCCAGGGCCAGCACAATGTGG + Intronic
1061078992 9:128358871-128358893 GCCCCAGGGCACCCCCAAGCAGG + Intronic
1062389526 9:136328354-136328376 GGCCCAGGGCAGCCCCTGGGGGG - Intronic
1062450075 9:136611479-136611501 TGCCCAGGGCAGGCCCAGTGTGG + Intergenic
1185484349 X:470950-470972 GGCTCAGAGCATCCCCAAAGTGG + Intergenic
1187267667 X:17750301-17750323 GGCCCAGGGAGAGCCCAATTTGG + Intronic
1187757987 X:22547158-22547180 TGCCCAGGGCACCCTCAATAAGG - Intergenic
1189086814 X:38034082-38034104 GGCCAAGTGCAACCACAATGGGG + Intronic
1190196052 X:48319343-48319365 GGCCCAGTGCTAGCCCAAAGTGG - Intergenic
1190209060 X:48429860-48429882 GGCCCAGTGCTAGCCCAAAGTGG - Intergenic
1190662753 X:52669696-52669718 GGCCCAGTGCTAGCCCAAAGTGG - Intronic
1190676677 X:52788787-52788809 GGCCCAGTGCTAGCCCAAAGTGG + Intronic
1192160595 X:68783644-68783666 GGCCCAGACCAACTCCAACGCGG + Intergenic
1198688006 X:139248468-139248490 GGCCCAAGACAATTCCAATGTGG + Intergenic