ID: 1084883852

View in Genome Browser
Species Human (GRCh38)
Location 11:72190620-72190642
Sequence TTTCTCCGGCGTGGCCCTCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 60}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084883843_1084883852 27 Left 1084883843 11:72190570-72190592 CCGCAGGAACTGAACCCAAAGGA 0: 1
1: 0
2: 0
3: 23
4: 281
Right 1084883852 11:72190620-72190642 TTTCTCCGGCGTGGCCCTCAAGG 0: 1
1: 0
2: 0
3: 7
4: 60
1084883847_1084883852 1 Left 1084883847 11:72190596-72190618 CCTGGTATTCCCTGAGAGTACAG 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1084883852 11:72190620-72190642 TTTCTCCGGCGTGGCCCTCAAGG 0: 1
1: 0
2: 0
3: 7
4: 60
1084883848_1084883852 -8 Left 1084883848 11:72190605-72190627 CCCTGAGAGTACAGATTTCTCCG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1084883852 11:72190620-72190642 TTTCTCCGGCGTGGCCCTCAAGG 0: 1
1: 0
2: 0
3: 7
4: 60
1084883841_1084883852 28 Left 1084883841 11:72190569-72190591 CCCGCAGGAACTGAACCCAAAGG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1084883852 11:72190620-72190642 TTTCTCCGGCGTGGCCCTCAAGG 0: 1
1: 0
2: 0
3: 7
4: 60
1084883849_1084883852 -9 Left 1084883849 11:72190606-72190628 CCTGAGAGTACAGATTTCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1084883852 11:72190620-72190642 TTTCTCCGGCGTGGCCCTCAAGG 0: 1
1: 0
2: 0
3: 7
4: 60
1084883846_1084883852 12 Left 1084883846 11:72190585-72190607 CCAAAGGATCACCTGGTATTCCC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1084883852 11:72190620-72190642 TTTCTCCGGCGTGGCCCTCAAGG 0: 1
1: 0
2: 0
3: 7
4: 60
1084883845_1084883852 13 Left 1084883845 11:72190584-72190606 CCCAAAGGATCACCTGGTATTCC 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1084883852 11:72190620-72190642 TTTCTCCGGCGTGGCCCTCAAGG 0: 1
1: 0
2: 0
3: 7
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084883852 Original CRISPR TTTCTCCGGCGTGGCCCTCA AGG Exonic
900611469 1:3546371-3546393 TTCCTCCTGCATGGCCCCCAAGG + Intronic
900883794 1:5401473-5401495 TTTCTCCAGGATGGCCCCCAGGG - Intergenic
901460176 1:9386580-9386602 TTCCTCTGGCTTGGCCCTCAAGG - Intergenic
901666402 1:10828576-10828598 TTTCTGTGGCGAGGCCCTCGGGG + Intergenic
912664073 1:111563465-111563487 TTTCTCCCGAATGTCCCTCAAGG - Intronic
1063043466 10:2368138-2368160 TTTTTCCTCCGTGGCCCACATGG + Intergenic
1065972285 10:30815194-30815216 TGTCTCCAGAGTGGCCCACAGGG + Intergenic
1070325642 10:75387152-75387174 ATTCTCCGGGGAAGCCCTCAAGG - Intergenic
1073636006 10:105199845-105199867 TTTCTCCTTAATGGCCCTCAAGG + Intronic
1076074831 10:127524999-127525021 TTTCCCCAGCGTGGTCCTCCAGG - Intergenic
1081669959 11:44937303-44937325 CTTCTCCGGCATTGCCATCATGG - Exonic
1084883852 11:72190620-72190642 TTTCTCCGGCGTGGCCCTCAAGG + Exonic
1088132353 11:106508538-106508560 CTTCCCTGGCTTGGCCCTCAGGG + Intergenic
1089271384 11:117303773-117303795 TTTCTTCTGTGTGGGCCTCATGG + Intronic
1101642740 12:106600393-106600415 TTTCTCTCGCGTGGCACTCTTGG + Intronic
1104727780 12:131088372-131088394 GATCTCCCGCGTGGCCCTTACGG - Intronic
1106122649 13:26873445-26873467 TTTCCCTGGCGTGGTCCTGATGG + Intergenic
1114612147 14:24049886-24049908 TTTCTCCATCTTGTCCCTCAAGG + Intergenic
1117230747 14:53715909-53715931 TTTCTCTGGGGTGGTCCTAAAGG + Intergenic
1121277818 14:92679615-92679637 TTTCTCTGGCTTAGCCCTCCTGG + Intronic
1128472083 15:67963012-67963034 TTTCTCCTGTGTGGCACACATGG - Intergenic
1128727066 15:69996075-69996097 TGTCACCAGCGTGGCTCTCAGGG - Intergenic
1131115052 15:89790371-89790393 CTTCTCCCACGTGGCCCTGAGGG - Intronic
1131312833 15:91306399-91306421 TTCCTGCAGCGTGGGCCTCACGG + Intergenic
1133054460 16:3138597-3138619 TGTCACCGGCGTTGCCCTAAGGG + Intronic
1134536682 16:15032079-15032101 TTTGGCCAGCGTGGCGCTCAGGG + Intronic
1136397582 16:30001481-30001503 TTTCTCCCGCTTGGGCCTCAGGG - Exonic
1143334172 17:6159903-6159925 TTTTTACTGCGTGGCCCTGACGG - Intergenic
1151975712 17:77482679-77482701 TTGCTCCAGCCTGGCCCTCCAGG + Intronic
1154223370 18:12477322-12477344 TTTCTCAGTCATGGCACTCAAGG - Intronic
1160694100 19:474294-474316 TATTTCCAGCGTGGCCCTCAGGG - Intronic
1166269332 19:41704312-41704334 TTTCCCTGCCCTGGCCCTCAAGG - Intronic
937349706 2:121153148-121153170 TGTCTCTGGCGTGGTCCTCATGG + Intergenic
1176223103 20:63979325-63979347 TTTCTCGGGCGGGGGTCTCAGGG - Intronic
1180244447 21:46537712-46537734 TGCCTCTGGCATGGCCCTCAGGG + Intronic
1185065853 22:48631332-48631354 TGTGTCCAGCGTGGCCCTCATGG - Intronic
950459754 3:13114250-13114272 TTTCTCGGGTGTGGCTCTCTAGG + Intergenic
962346438 3:134622716-134622738 TTTCTTCGTAGGGGCCCTCAGGG + Intronic
963511069 3:146250579-146250601 TTTCTACGGCGCGGCTCTCACGG - Intronic
969566836 4:7983733-7983755 TTTCCCGGGGGAGGCCCTCAGGG - Intronic
970191466 4:13522983-13523005 TTTCTCCTGCGAGGCCACCACGG - Intergenic
971140482 4:23920045-23920067 TTGCTCCTACGTGGACCTCAAGG - Intergenic
978280634 4:107008129-107008151 TTTCACCTACGTGGCCTTCATGG - Intronic
1000450937 5:161386150-161386172 TTTATCCTAAGTGGCCCTCATGG + Intronic
1004342463 6:14819403-14819425 TTTCTATGGCATTGCCCTCATGG + Intergenic
1006650136 6:35544814-35544836 TTGCTCCTGCGTGGGTCTCAGGG + Intergenic
1010530969 6:76966878-76966900 CTTCAAGGGCGTGGCCCTCATGG + Intergenic
1012281342 6:97331126-97331148 TTTCTCCAGCCTGGCCAACATGG + Intergenic
1016909399 6:149182601-149182623 TTTCTAAGGCCTGGCCCTCCTGG - Intergenic
1019055774 6:169222271-169222293 CTACTCCGGCGTGTCCCTCAAGG - Exonic
1024678120 7:51656354-51656376 TTTGTAAGGCGTGCCCCTCACGG + Intergenic
1024913220 7:54469908-54469930 TGTCTCGGGGGTGGCCCTCCTGG + Intergenic
1029218791 7:98971402-98971424 ATGCTCCGCCGTGGCCCTGAAGG + Intronic
1033043633 7:137940834-137940856 TTTCCCCAGTGTGGCCCTCTAGG - Intronic
1035754448 8:2021270-2021292 TGTCTCCCCCGTGGCACTCAGGG + Intergenic
1038327741 8:26585395-26585417 TCTCTCTGTCCTGGCCCTCAGGG + Intronic
1038437076 8:27543762-27543784 CTTCTCCGCCGTGACCATCAGGG - Exonic
1039260251 8:35763823-35763845 TGTCTCCTGCCTGGCCTTCAAGG - Intronic
1043297458 8:78683291-78683313 TTTCAGGGGCGGGGCCCTCATGG - Intronic
1044270314 8:90234917-90234939 TTTCACTGCAGTGGCCCTCAAGG - Intergenic
1047586919 8:126282954-126282976 TTTCAGGGGCGAGGCCCTCATGG + Intergenic
1048800976 8:138193644-138193666 TGGCTCCGGCCAGGCCCTCAGGG + Intronic
1049153844 8:141055261-141055283 CTGCTCCAGCTTGGCCCTCAGGG + Intergenic
1049371298 8:142268805-142268827 CTTCTCTGCCGTGGTCCTCATGG - Intronic
1061897491 9:133656019-133656041 TTTCTCCAACGTGGCTCTGAGGG - Intronic
1193908360 X:87270431-87270453 TTTCATCAGCCTGGCCCTCAGGG - Intergenic
1202369849 Y:24189101-24189123 TTTCTCCACCCTGGCCCCCAGGG - Intergenic
1202500935 Y:25481016-25481038 TTTCTCCACCCTGGCCCCCAGGG + Intergenic