ID: 1084885871

View in Genome Browser
Species Human (GRCh38)
Location 11:72206509-72206531
Sequence TGGGCCTGGCCAAAATGCAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084885863_1084885871 12 Left 1084885863 11:72206474-72206496 CCTTCCAAAGTGCTGGGATTACG 0: 95
1: 12671
2: 309958
3: 266077
4: 148813
Right 1084885871 11:72206509-72206531 TGGGCCTGGCCAAAATGCAACGG No data
1084885866_1084885871 8 Left 1084885866 11:72206478-72206500 CCAAAGTGCTGGGATTACGGGTG 0: 646
1: 71746
2: 207097
3: 251626
4: 205354
Right 1084885871 11:72206509-72206531 TGGGCCTGGCCAAAATGCAACGG No data
1084885859_1084885871 24 Left 1084885859 11:72206462-72206484 CCGCCACGTTGGCCTTCCAAAGT 0: 2
1: 32
2: 645
3: 2023
4: 4305
Right 1084885871 11:72206509-72206531 TGGGCCTGGCCAAAATGCAACGG No data
1084885860_1084885871 21 Left 1084885860 11:72206465-72206487 CCACGTTGGCCTTCCAAAGTGCT 0: 27
1: 2765
2: 65696
3: 154956
4: 160668
Right 1084885871 11:72206509-72206531 TGGGCCTGGCCAAAATGCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084885871 Original CRISPR TGGGCCTGGCCAAAATGCAA CGG Intergenic
No off target data available for this crispr