ID: 1084887674

View in Genome Browser
Species Human (GRCh38)
Location 11:72221624-72221646
Sequence AGCCCAGGGCAACCCCAACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 2, 2: 2, 3: 82, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084887670_1084887674 4 Left 1084887670 11:72221597-72221619 CCGCTGCATCCAGATGTGGTTTG 0: 2
1: 3
2: 1
3: 15
4: 208
Right 1084887674 11:72221624-72221646 AGCCCAGGGCAACCCCAACGAGG 0: 1
1: 2
2: 2
3: 82
4: 218
1084887671_1084887674 -5 Left 1084887671 11:72221606-72221628 CCAGATGTGGTTTGATTCAGCCC 0: 1
1: 1
2: 0
3: 9
4: 88
Right 1084887674 11:72221624-72221646 AGCCCAGGGCAACCCCAACGAGG 0: 1
1: 2
2: 2
3: 82
4: 218
1084887668_1084887674 16 Left 1084887668 11:72221585-72221607 CCGAGGGAGCGGCCGCTGCATCC 0: 1
1: 2
2: 1
3: 14
4: 129
Right 1084887674 11:72221624-72221646 AGCCCAGGGCAACCCCAACGAGG 0: 1
1: 2
2: 2
3: 82
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084887674 Original CRISPR AGCCCAGGGCAACCCCAACG AGG Exonic
900359327 1:2280432-2280454 AGACCAGGCCTTCCCCAACGAGG - Intronic
900412195 1:2517666-2517688 AGGCCAGGGCAAACCCACTGGGG + Intronic
903060334 1:20664509-20664531 CTCCCAGGGCAGCCCCAACCAGG - Exonic
903442035 1:23395387-23395409 AGCACAGGGCCACTCCAAAGAGG + Intronic
905342988 1:37292058-37292080 AGCCCACAGCAACGCCAAGGTGG + Intergenic
908751669 1:67430105-67430127 GGCCCAGACCAACTCCAACGCGG - Exonic
916721761 1:167489752-167489774 AGCCCAGGGCAGCCCCCTCCTGG + Intronic
920055002 1:203185113-203185135 AGGGCAGGGCAACCCCACCCAGG - Intronic
922717394 1:227884670-227884692 AGCCCAGGGCACCCCAGACTGGG - Intergenic
1065289465 10:24215258-24215280 AGCCCAGGGCAACTCCTCCTGGG - Intronic
1067661104 10:48236680-48236702 AGCCCAGGTCAGCCCCATCTTGG - Intronic
1070755997 10:78993691-78993713 AGCCCAGGGCCAGCCCACCGAGG + Intergenic
1073190733 10:101649076-101649098 AGCCCAGGGAATCCCCAAAGAGG + Intronic
1075618915 10:123911379-123911401 AGAGCAGGGCAGCCCCAAGGGGG + Intronic
1076275254 10:129192996-129193018 GGCACAGGGCAGCCCCAATGTGG + Intergenic
1076313043 10:129521751-129521773 GGCCCAGGGCAAGTCCCACGAGG + Intronic
1077216771 11:1398310-1398332 GGCCCAGGCCAGCCCCAACCAGG - Intronic
1078672042 11:13374377-13374399 AGCACAGGGCAACTACAAGGGGG - Intronic
1079356865 11:19737061-19737083 AGCCCAAGGCAACACCACTGGGG + Intronic
1081498784 11:43644635-43644657 AGCCCAGTCCAACCCCAAATAGG - Intronic
1083715128 11:64570991-64571013 AGCCCAGGGCAACCGGCAAGAGG + Exonic
1083878252 11:65536015-65536037 AGCCCAGGACACCCGCAACCCGG - Exonic
1084876898 11:72139741-72139763 AGCCCAGGGCAACCCCAATGAGG + Exonic
1084879431 11:72159613-72159635 GGCCCAGGGCAACCCCAATGAGG + Intergenic
1084881963 11:72177881-72177903 AGCCCAGGGCAACCCCAGTGAGG + Intergenic
1084884700 11:72196051-72196073 AGCCCAGGGCAACCCCAATGAGG + Exonic
1084887674 11:72221624-72221646 AGCCCAGGGCAACCCCAACGAGG + Exonic
1087094705 11:94307578-94307600 TGCTCAGGGCAACCCCAATGTGG + Intronic
1087368259 11:97248799-97248821 AGCCTAGAGCAGCCTCAACGGGG - Intergenic
1089334142 11:117711197-117711219 AGCCCAGGGCAAAGCAAATGAGG + Intronic
1089610178 11:119664576-119664598 AGCCCAGGGCAGCCACGACTTGG - Exonic
1096871457 12:54595091-54595113 AGACCAGCCCAACCCCAACCAGG - Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1105206889 13:18232964-18232986 CGCCCAGGGCATCGCCAACTGGG + Intergenic
1105206916 13:18233099-18233121 CGCCCAGGGCATCGCCGACGGGG + Intergenic
1105206933 13:18233180-18233202 CGCCCAGGGCATCGCCAACTGGG + Intergenic
1105206980 13:18233423-18233445 TGCCCAGGGCATCGCCAACTGGG + Intergenic
1105207034 13:18233666-18233688 CGCCCAGGGCATCGCCGACGGGG + Intergenic
1105207046 13:18233720-18233742 CGCCCAGGGCATCGCCAACTGGG + Intergenic
1105207071 13:18233828-18233850 CGCCCAGGGCATCGCCGACGGGG + Intergenic
1105207197 13:18234442-18234464 CGCCCAGGGCATCGCCGACGGGG + Intergenic
1105207206 13:18234469-18234491 CGCCCAGGGCATCGCCGACGGGG + Intergenic
1105207215 13:18234496-18234518 CGCCCAGGGCATCGCCGACGGGG + Intergenic
1105207224 13:18234523-18234545 CGCCCAGGGCATCGCCGACGGGG + Intergenic
1105207311 13:18234949-18234971 CGCCCAGGGCATCGCTAACGAGG + Intergenic
1105207434 13:18235537-18235559 CGCCCAGGGCATCGCCAACGAGG + Exonic
1105207461 13:18235696-18235718 CACCCAGGGCATCGCCAACGAGG + Exonic
1105207483 13:18235774-18235796 TGCCCAGGGCATCGCCAATGGGG + Exonic
1105207518 13:18235909-18235931 CGCCCAGGGCATCGCCAACGGGG + Exonic
1105207542 13:18236017-18236039 CGCCCAGGGCATCGCCAACGAGG + Exonic
1105207555 13:18236068-18236090 CGCACAGGGCATCGCCAACGAGG + Exonic
1105207560 13:18236095-18236117 CGCCCAGGGCATCGCCAACAAGG + Exonic
1105207568 13:18236122-18236144 CGCCCAGGGCATCGCCAACGAGG + Exonic
1105207580 13:18236173-18236195 CGCACAGGGCATCGCCAACGAGG + Exonic
1105207585 13:18236200-18236222 CGCCCAGGGCATCGCCAACGAGG + Exonic
1105207594 13:18236227-18236249 CGCCCAGGGCATCGCCAACAGGG + Exonic
1105207639 13:18236437-18236459 CGCCCAGGGCATCGCCAACTGGG + Exonic
1105207683 13:18236599-18236621 CGCCCAGGGCATCCCTGACGGGG + Exonic
1105207718 13:18236788-18236810 TGCCCAGGGCATCGCTAACGAGG + Exonic
1105207724 13:18236815-18236837 CGCCCAGGGCATCGCTAACGAGG + Exonic
1106076436 13:26465005-26465027 AGGCCAGAGCAACCACAACAGGG + Intergenic
1106203064 13:27559930-27559952 AGACCAGGGAAACCCCAGCCTGG - Exonic
1106575553 13:30971043-30971065 AGCCCAAGGCAGCCCCAAAGAGG - Intronic
1110164813 13:72428383-72428405 AGCACAGGGCAATCCCATTGTGG - Intergenic
1115956996 14:38792372-38792394 TCCACAGGGCAACCCCAAGGAGG + Intergenic
1119610402 14:76056913-76056935 TGCCCAGGGCATCCCCAGCCTGG - Intronic
1121442888 14:93959820-93959842 AGCCCAGGTCAGCCCCAGGGAGG + Intronic
1202902193 14_GL000194v1_random:50387-50409 AGCCGAGGGCGACCCCAACACGG + Intergenic
1130044063 15:80430484-80430506 AGCCCTGGGCTATCCCAACAGGG - Intronic
1132689144 16:1174816-1174838 AGGCCAGGGCCACGCCAACTCGG - Intronic
1134128639 16:11633193-11633215 AGCCCAGGGCCACCTGAACAGGG + Intronic
1138596071 16:58029599-58029621 ACCCAAGGGCAGCCCCAACTCGG - Intronic
1141579372 16:84986736-84986758 TGTCCAGGGCAATCCCAGCGAGG + Intronic
1149786213 17:59437458-59437480 AGCCCAGTTCAACACCAACCTGG - Intergenic
1150834427 17:68551822-68551844 TTCCCAGGGCCACCCCAACTGGG + Intronic
1151493998 17:74448843-74448865 AGGCCAGGCCAACACCAACCAGG + Intronic
1151924062 17:77180716-77180738 AGCCCAGAGCAACCACAGCTAGG - Intronic
1152285712 17:79411525-79411547 GGGCCAGGGCAGCCCCAAGGAGG - Intronic
1152740025 17:82014742-82014764 GGCCCACGTCAACCCCCACGGGG - Intronic
1155185448 18:23383293-23383315 AGCCCAGGGAAACCCTGAAGAGG + Intronic
1158087807 18:53673805-53673827 AGCCCAGGCTAAACCCAAAGTGG - Intergenic
1161296616 19:3523458-3523480 AGCCCAGGGCAAGGCAAACACGG - Intronic
1161964718 19:7541622-7541644 AGCCCAGGGAGACCCCAGGGCGG + Exonic
1163390777 19:17028512-17028534 AGACCAGGCCAACCCCAAACAGG + Intergenic
1163591015 19:18194135-18194157 AGTCCAGGGCGACCCAAACAGGG - Intronic
1165393305 19:35550462-35550484 AGCCCACGGCACCCCAAACTTGG - Exonic
1168694492 19:58396844-58396866 GGCCCAGGGCGACCCCGGCGGGG - Exonic
926299014 2:11589002-11589024 AGCCCAAGTCAGCCCCCACGAGG - Intronic
927273946 2:21245648-21245670 AGCCCAGGGGAATCACAACAAGG - Intergenic
934088360 2:88529285-88529307 GGCCCAGGGTGACCCCAACCAGG + Exonic
934504493 2:94880044-94880066 AGCCGAGGGTGACCCCAACACGG - Intergenic
934753304 2:96808457-96808479 AGCCCAGGGACACCCCACCCAGG - Intronic
940863257 2:158791587-158791609 AGCACAGGGCAGCCCCAAAGTGG - Intergenic
941991150 2:171558917-171558939 AGGTCAGGGGAGCCCCAACGTGG + Intergenic
945419169 2:209613846-209613868 AGCCCAGGGTAACCCAAGCAAGG + Intronic
947526561 2:230880243-230880265 AGCCCAGTGCAACCCAACAGAGG + Intergenic
949045877 2:241872449-241872471 AGCCCTGGGCCACGCCAACCGGG - Exonic
1169356752 20:4913162-4913184 ATCCCAGGGCAACCTCAGCAGGG + Intronic
1172175702 20:32970682-32970704 AGACCAGGACAAGCCCACCGTGG - Intergenic
1172703199 20:36864778-36864800 AGCCCATGCCAGCCCCCACGGGG - Intergenic
1174382261 20:50163670-50163692 AGCCCAGGGGAAGCCCACAGAGG - Intergenic
1175221798 20:57421440-57421462 AGGCCAGGGAAACCGCCACGGGG + Intergenic
1175391351 20:58629396-58629418 AGCCCAGAGCAGCCCCCACTGGG + Intergenic
1175766585 20:61596752-61596774 AGTCCAGGGCAGCCCCACGGAGG - Intronic
1175981401 20:62740597-62740619 AGCCCAGGGGAGCCCCCACCTGG + Intronic
1176296748 21:5077019-5077041 AGCCCCGGGAAACCCCATGGGGG - Intergenic
1176621561 21:9065154-9065176 AGCCGAGGGCGACCCCAACACGG + Intergenic
1177594752 21:23224143-23224165 ATCCCAAGGCAGCCCCAAGGTGG + Intergenic
1179015940 21:37594622-37594644 TGCCCAGGGCAACGCCCACCCGG - Intergenic
1179860301 21:44185102-44185124 AGCCCCGGGAAACCCCATGGGGG + Intergenic
1180759116 22:18186071-18186093 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180759131 22:18186125-18186147 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180759139 22:18186152-18186174 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180759146 22:18186179-18186201 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180759153 22:18186206-18186228 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180759166 22:18186260-18186282 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180769440 22:18370432-18370454 CGCCCACGGCATCGCCAACGAGG - Intergenic
1180769446 22:18370459-18370481 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180769454 22:18370486-18370508 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180769461 22:18370513-18370535 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180769474 22:18370567-18370589 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180776850 22:18492083-18492105 CGACAAGGGCAACGCCAACGAGG + Intergenic
1180776855 22:18492110-18492132 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180776868 22:18492164-18492186 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180776875 22:18492191-18492213 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180776882 22:18492218-18492240 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180776889 22:18492245-18492267 CGTCCAGGGCATCGCCAACGAGG + Intergenic
1180776894 22:18492272-18492294 CGCCCACGGCATCGCCAACGAGG + Intergenic
1180809578 22:18749449-18749471 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180809585 22:18749476-18749498 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180809598 22:18749530-18749552 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180809605 22:18749557-18749579 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180809612 22:18749584-18749606 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1180827248 22:18872871-18872893 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1180827255 22:18872898-18872920 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180827262 22:18872925-18872947 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180827288 22:18873033-18873055 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180827295 22:18873060-18873082 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180827302 22:18873087-18873109 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1180827310 22:18873114-18873136 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180827317 22:18873141-18873163 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180827325 22:18873168-18873190 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180827333 22:18873195-18873217 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1180827359 22:18873303-18873325 CGCCCACGGCATCGCCAACGAGG - Intergenic
1180827365 22:18873330-18873352 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180827374 22:18873357-18873379 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180827382 22:18873384-18873406 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1180827399 22:18873438-18873460 CGCCCAGGGCATCGCCAGCGAGG - Intergenic
1181072495 22:20354464-20354486 CGCCCAGGGCATCGCTAACGAGG + Intronic
1181072551 22:20354788-20354810 CGCCCAGGGCATCGCTAACGAGG + Intronic
1181072560 22:20354842-20354864 AGCCCAGGACATCGCAAACGAGG + Intronic
1181072806 22:20356089-20356111 TGCCCAGGGCATCGCGAACGAGG + Intronic
1181072812 22:20356116-20356138 CGCCCAGGGCATCGCTAACGAGG + Intronic
1181072860 22:20356359-20356381 TGCCCAGGGCATCGCGAACGAGG + Intronic
1181073002 22:20357091-20357113 CGCCCAGGGCATCGCTAACGAGG + Intronic
1181073018 22:20357172-20357194 CGCCCAGGGCATCGCGAACGAGG + Intronic
1181073148 22:20357877-20357899 TGCCCAGGGCATCGCGAACGAGG + Intronic
1181073154 22:20357904-20357926 CGCCCAGGGCATCGCTAACGAGG + Intronic
1181073171 22:20357985-20358007 CGCCCAGGGCATCGCGAACGAGG + Intronic
1181073274 22:20358528-20358550 CGCCCAGGGCATCGCTAACGAGG + Intronic
1181073325 22:20358800-20358822 CGCCCAGGGCATCGCTAACGAGG + Intronic
1181073342 22:20358881-20358903 CGCCCAGGGCATCGCGAACGAGG + Intronic
1181073398 22:20359178-20359200 CGCCCAGGGCATCGCGAACGAGG + Intronic
1181073490 22:20359694-20359716 TGCCCAGGGCATCGCGAACGAGG + Intronic
1181073496 22:20359721-20359743 CGCCCAGGGCATCGCTAACGAGG + Intronic
1181073513 22:20359802-20359824 CGCCCAGGGCATCGCGAACGAGG + Intronic
1181073570 22:20360099-20360121 CGCCCAGGGCATCGCGAACGAGG + Intronic
1181073653 22:20360531-20360553 CGCCCACGGCATCGCCAACGAGG + Intronic
1181073659 22:20360558-20360580 TGCCCAGGGCATCGCGAACGAGG + Intronic
1181073715 22:20360828-20360850 CGCCCAGGGCATCGCGAACGAGG + Intronic
1181073776 22:20361152-20361174 CGCCCAGGGCATCGCTAACGAGG + Intronic
1181195589 22:21183476-21183498 CGCCCAGGGCATCGCCAGCGAGG + Intergenic
1181195596 22:21183503-21183525 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195614 22:21183584-21183606 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195621 22:21183611-21183633 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195629 22:21183638-21183660 CGCCCAGGGCATCGCCAAGGAGG + Intergenic
1181195636 22:21183665-21183687 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195644 22:21183692-21183714 CGCCCAGGGCATCGCCAAAGAGG + Intergenic
1181195651 22:21183719-21183741 CGCCCAGGGCATCGCTAACGAGG + Intergenic
1181195662 22:21183773-21183795 CGCCCACGGCATCGCCAACGAGG + Intergenic
1181195687 22:21183881-21183903 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195705 22:21183962-21183984 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195712 22:21183989-21184011 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195720 22:21184016-21184038 CGCCCAGGGCATCGCCAAGGAGG + Intergenic
1181195728 22:21184043-21184065 CGCCCAGGGCATCGCCAAGGAGG + Intergenic
1181195735 22:21184070-21184092 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195743 22:21184097-21184119 CGCCCAGGGCATCGCCAAAGAGG + Intergenic
1181195749 22:21184124-21184146 CGCCCACGGCATCGCCAACGAGG + Intergenic
1181195756 22:21184151-21184173 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195781 22:21184259-21184281 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195788 22:21184286-21184308 CGCCCAGGGCATCGCCAACGAGG + Intergenic
1181195795 22:21184313-21184335 CGCCCAGGGCATCGCCAAAGAGG + Intergenic
1181213734 22:21308811-21308833 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1181213741 22:21308838-21308860 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213748 22:21308865-21308887 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213774 22:21308973-21308995 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213781 22:21309000-21309022 CGCCCATGGCATCGCCAACGAGG - Intergenic
1181213787 22:21309027-21309049 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1181213795 22:21309054-21309076 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213802 22:21309081-21309103 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1181213810 22:21309108-21309130 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1181213817 22:21309135-21309157 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213824 22:21309162-21309184 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1181213832 22:21309189-21309211 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213844 22:21309243-21309265 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1181213852 22:21309270-21309292 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1181213877 22:21309378-21309400 CGCCCACGGCATCGCCAACGAGG - Intergenic
1181412122 22:22731323-22731345 AGCCCTGGGCAGGCCCTACGAGG - Intergenic
1181419271 22:22786480-22786502 AGCCCAGGGCAGGCCCTACCAGG - Intronic
1182621179 22:31619620-31619642 AGCCCAGGGCTTCCCCAAAGCGG + Exonic
1182797364 22:33000651-33000673 AACCCACCCCAACCCCAACGGGG - Intronic
1184390880 22:44202398-44202420 AGCCCAGGGGCACCCCAGAGTGG - Intronic
1203231006 22_KI270731v1_random:110528-110550 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1203231013 22_KI270731v1_random:110555-110577 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231020 22_KI270731v1_random:110582-110604 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231039 22_KI270731v1_random:110663-110685 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231046 22_KI270731v1_random:110690-110712 CGCCCACGGCATCGCCAACGAGG - Intergenic
1203231052 22_KI270731v1_random:110717-110739 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1203231059 22_KI270731v1_random:110744-110766 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231066 22_KI270731v1_random:110771-110793 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231074 22_KI270731v1_random:110798-110820 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231082 22_KI270731v1_random:110825-110847 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231101 22_KI270731v1_random:110906-110928 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231108 22_KI270731v1_random:110933-110955 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231115 22_KI270731v1_random:110960-110982 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231129 22_KI270731v1_random:111014-111036 CGCCCAGGGCATCGCCAGCGAGG - Intergenic
1203231136 22_KI270731v1_random:111041-111063 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231149 22_KI270731v1_random:111095-111117 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231156 22_KI270731v1_random:111122-111144 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231164 22_KI270731v1_random:111149-111171 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231172 22_KI270731v1_random:111176-111198 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1203231179 22_KI270731v1_random:111203-111225 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231186 22_KI270731v1_random:111230-111252 CGCCCAGGGCATCGCCAGCGAGG - Intergenic
1203231193 22_KI270731v1_random:111257-111279 CGCCCAGGGCATCGCCAGCGAGG - Intergenic
1203231229 22_KI270731v1_random:111419-111441 CGCCCAGGGCATCGCTAACGAGG - Intergenic
1203231236 22_KI270731v1_random:111446-111468 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231244 22_KI270731v1_random:111473-111495 CGCCCAGGGCATCGCCAAAGAGG - Intergenic
1203231251 22_KI270731v1_random:111500-111522 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231258 22_KI270731v1_random:111527-111549 CGCCCAGGGCATCGCCAAGGAGG - Intergenic
1203231266 22_KI270731v1_random:111554-111576 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203231285 22_KI270731v1_random:111635-111657 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277431 22_KI270734v1_random:99212-99234 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277438 22_KI270734v1_random:99239-99261 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277457 22_KI270734v1_random:99320-99342 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277464 22_KI270734v1_random:99347-99369 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277471 22_KI270734v1_random:99374-99396 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277478 22_KI270734v1_random:99401-99423 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277485 22_KI270734v1_random:99428-99450 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277492 22_KI270734v1_random:99455-99477 CGCCCAGGGCATCGCCAACGAGG - Intergenic
1203277499 22_KI270734v1_random:99482-99504 CGCCCAGGGCATCGCCAGCGAGG - Intergenic
1203277512 22_KI270734v1_random:99536-99558 CGCCCAGGGCATCGCCAACGAGG - Intergenic
953528335 3:43714080-43714102 AGCCCAGGGCAAGGCCCACAAGG - Intronic
954420322 3:50415551-50415573 AGCCCATGGTAACCCCAAGGAGG - Intronic
957127754 3:76184292-76184314 AGCCCAGGGCAACCCACTGGAGG - Intronic
961448692 3:126992691-126992713 ACCCCAGGGCACCCCCACCCTGG - Intronic
968699280 4:2047081-2047103 AGCCCAGGGGAACCCCAGGACGG - Intergenic
968799568 4:2733240-2733262 GGCCCAGGGCACCCCCACCCAGG + Intergenic
969663799 4:8545431-8545453 ATCCCAGGGTGTCCCCAACGGGG + Intergenic
971227526 4:24768887-24768909 AGCCCAGCCCAGCCCCAAAGTGG + Intergenic
971389852 4:26175615-26175637 ACCCCAGGGAAACCCCATCTAGG - Intronic
973957644 4:56078798-56078820 AGCCAAGGGTAACCCCCACCAGG - Intergenic
974091665 4:57317546-57317568 ACCCCAGGGCTACCACAACAGGG + Intergenic
975812272 4:78181851-78181873 GGCCCAGACCAACTCCAACGCGG - Intronic
984937184 4:184899584-184899606 TGCCCAGGCCAACACCAACGTGG + Intergenic
990761798 5:59138011-59138033 AGCCCCTAGCAACCCTAACGAGG + Intronic
991971673 5:72147580-72147602 AGCCCAGGGCAAGGCCTGCGAGG + Intronic
992007512 5:72492311-72492333 AGCACAGGGCCTCCCCAACATGG + Intronic
992615643 5:78543635-78543657 AGCCCAGGGCAGCCCCACTAGGG + Intronic
998174956 5:139895991-139896013 AGCACAGGCCCACCCCAAAGAGG - Intronic
998352090 5:141508519-141508541 ACCTCAGGGCACCCCCCACGAGG + Intronic
1001951719 5:175821028-175821050 ATCCCAGGACAACCCCCAGGAGG - Intronic
1002194647 5:177495356-177495378 AGCCCAAGGCAAGCCCAGCCTGG - Intronic
1007473360 6:42104670-42104692 GGCCCAGGGCTACCCCACGGTGG - Exonic
1017716918 6:157219152-157219174 AGGCCAGGGCACCCCCACCTAGG - Intergenic
1019397826 7:832249-832271 AGACCAGGGGAACCCTAAAGTGG - Intronic
1019617837 7:1974275-1974297 AGCACAGGGCAAACCCACCCTGG + Intronic
1019778563 7:2926577-2926599 AGCCATGGGCAAGCCCAATGGGG + Intronic
1020746988 7:12090945-12090967 AGCCCAGGGCCCCCCCACAGTGG + Intergenic
1022785882 7:33636147-33636169 AGCCAAGGGCAACAGCAAGGAGG + Intergenic
1025211503 7:57021514-57021536 AGCCCAGGTCAAGACCCACGTGG - Intergenic
1025660452 7:63555333-63555355 AGCCCAGGTCAAGACCCACGTGG + Intergenic
1035384123 7:158459061-158459083 AGCCCAGGGCAGCCACACCAAGG - Intronic
1036390958 8:8324081-8324103 AGCCCAGGGCAAGCACAATGGGG + Intronic
1046055267 8:109071240-109071262 AGCCCAGGCCAGCCCCAGAGAGG + Intergenic
1049311670 8:141936875-141936897 AGCCCAGGTCACCCCGAATGGGG - Intergenic
1049374285 8:142281676-142281698 AGCCAAGGGCAACCCCATAGAGG + Intronic
1049718834 8:144106291-144106313 AGCCCAGGGCTACCCAAAGTGGG - Intronic
1050652658 9:7790517-7790539 AGCCCAGGGACCCCCCAAAGTGG - Intergenic
1051889031 9:21924618-21924640 AGCCCTGGGTAAACCCAATGAGG - Intronic
1052603697 9:30671803-30671825 AGCCCAGGGCAGGCCCTACCAGG - Intergenic
1058939144 9:109797255-109797277 AGCTCAGGGTAACCCCAAGCTGG - Intronic
1061618683 9:131796702-131796724 CACCCAGGGCCACCCCACCGAGG + Intergenic
1203744746 Un_GL000218v1:35564-35586 AGCCGAGGGCGACCCCAACACGG + Intergenic
1203565359 Un_KI270744v1:83920-83942 AGCTGAGGGCGACCCCAACACGG - Intergenic
1185552793 X:997489-997511 TGCCCAGGACAGCCCCACCGCGG + Intergenic
1185660829 X:1727661-1727683 AGCCCAGGGAAATTCCGACGAGG - Intergenic
1186655340 X:11605910-11605932 AGCCAAGAGCAACCCCATCCCGG + Intronic
1189513207 X:41684385-41684407 AACCCTGGGCAAACCCAAAGAGG + Intronic
1192160595 X:68783644-68783666 GGCCCAGACCAACTCCAACGCGG + Intergenic
1192312618 X:70029239-70029261 AGCCCAAGGCAAGCCCCACCGGG - Intronic
1200045189 X:153397256-153397278 AGCCCAGGGGAATGCCAGCGAGG - Intergenic
1200096978 X:153669101-153669123 AGCCCAGGTCTACCCCAGCCTGG + Intergenic
1200251916 X:154558441-154558463 AGCCCGGGGCAACCCGCAAGCGG - Intronic
1200265851 X:154645975-154645997 AGCCCGGGGCAACCCGCAAGCGG + Intergenic
1201158084 Y:11150607-11150629 AGCCGAGGGCGACCCCAACACGG + Intergenic