ID: 1084888467

View in Genome Browser
Species Human (GRCh38)
Location 11:72224959-72224981
Sequence GGGCGGTGCTGAGCCCTGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 294}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084888453_1084888467 18 Left 1084888453 11:72224918-72224940 CCCTGAGCGTCTCGGGGCGGATG 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1084888467 11:72224959-72224981 GGGCGGTGCTGAGCCCTGCGCGG 0: 1
1: 0
2: 3
3: 32
4: 294
1084888446_1084888467 29 Left 1084888446 11:72224907-72224929 CCCAGCCTCAGCCCTGAGCGTCT 0: 1
1: 0
2: 2
3: 30
4: 273
Right 1084888467 11:72224959-72224981 GGGCGGTGCTGAGCCCTGCGCGG 0: 1
1: 0
2: 3
3: 32
4: 294
1084888450_1084888467 24 Left 1084888450 11:72224912-72224934 CCTCAGCCCTGAGCGTCTCGGGG 0: 1
1: 1
2: 1
3: 17
4: 185
Right 1084888467 11:72224959-72224981 GGGCGGTGCTGAGCCCTGCGCGG 0: 1
1: 0
2: 3
3: 32
4: 294
1084888454_1084888467 17 Left 1084888454 11:72224919-72224941 CCTGAGCGTCTCGGGGCGGATGG 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1084888467 11:72224959-72224981 GGGCGGTGCTGAGCCCTGCGCGG 0: 1
1: 0
2: 3
3: 32
4: 294
1084888447_1084888467 28 Left 1084888447 11:72224908-72224930 CCAGCCTCAGCCCTGAGCGTCTC 0: 1
1: 0
2: 3
3: 53
4: 414
Right 1084888467 11:72224959-72224981 GGGCGGTGCTGAGCCCTGCGCGG 0: 1
1: 0
2: 3
3: 32
4: 294
1084888445_1084888467 30 Left 1084888445 11:72224906-72224928 CCCCAGCCTCAGCCCTGAGCGTC 0: 1
1: 2
2: 7
3: 39
4: 440
Right 1084888467 11:72224959-72224981 GGGCGGTGCTGAGCCCTGCGCGG 0: 1
1: 0
2: 3
3: 32
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084888467 Original CRISPR GGGCGGTGCTGAGCCCTGCG CGG Exonic
900157390 1:1208736-1208758 GGGGGGTGCTGTGCCCAGAGGGG + Intergenic
900163663 1:1236283-1236305 GGTGTGTGCTGAGCCCTGCGGGG - Intergenic
900283900 1:1890471-1890493 GGGCGGGGCCGGGCCCTGCGTGG - Intronic
900403910 1:2484094-2484116 GGGAGGTGTTGACTCCTGCGTGG + Intronic
900420574 1:2554331-2554353 GGGGGGCGCTGAGCGCTGGGTGG + Intergenic
900569101 1:3349630-3349652 GGGCGGCCCTGAGCTCTGCCGGG - Intronic
901318854 1:8327040-8327062 AGGCAGAGCTCAGCCCTGCGGGG + Intronic
901428578 1:9198888-9198910 CAGCAGTGCTGAGCGCTGCGGGG - Intergenic
901513003 1:9727255-9727277 CGGCGGTGCTGGGCCCCCCGAGG + Exonic
901540213 1:9910454-9910476 GGGCGGGGCTGCGCGGTGCGGGG + Intergenic
901577355 1:10211096-10211118 GGCCGGTGCAGGGCACTGCGGGG - Intronic
902306317 1:15542395-15542417 GGAGGGTGGTGAGCCCTGGGAGG + Intronic
902391470 1:16109581-16109603 GGGCTGTGCTAAGTCCTGCACGG - Intergenic
903021928 1:20400721-20400743 GGGGGGTGGTGAGCCCAGAGAGG + Intergenic
903184698 1:21622500-21622522 GCGCGGAGCTCAGCGCTGCGGGG - Intronic
903285405 1:22273691-22273713 GGGTGGTGCTGAGGCCTGAGGGG + Intergenic
903870670 1:26432191-26432213 GGGCGGTTCTCAGTCCCGCGGGG - Intergenic
904029984 1:27527891-27527913 GGGCGGCGCTGGGGCCGGCGAGG - Intergenic
906525378 1:46490476-46490498 GGGAGTTGCGGAGCCCTGGGCGG + Intergenic
906725376 1:48040420-48040442 GGGCTGTGCGGAGCCATGAGTGG + Intergenic
908561401 1:65309958-65309980 GTGCAGCGCTGAGCCCCGCGCGG + Intronic
913047953 1:115089547-115089569 GGGCGGGGCGGGGCCCGGCGGGG + Intergenic
914428621 1:147600253-147600275 GGGCGGCTCTCAGCCCCGCGGGG - Intronic
914988697 1:152480240-152480262 GGGCGGAGAGGAGCCCTGCAGGG - Intergenic
915553215 1:156646915-156646937 GGGCTGTGCTGGGCTCTCCGCGG + Exonic
923545470 1:234920249-234920271 GGGTGGTGGTGAGCCCAGCCTGG - Intergenic
924527063 1:244863022-244863044 GGGAGGGGCCGAGCCCGGCGCGG + Intronic
1064712388 10:18140618-18140640 GGCCGGGCCTGAGCCCTGGGCGG + Intergenic
1067098094 10:43315464-43315486 GGGCAGTGCTGCCCTCTGCGAGG + Intergenic
1067467552 10:46512325-46512347 GGGAGGTGTTGAGCTCTGCATGG + Intergenic
1067542434 10:47165760-47165782 GGGCTCTGCTGTGCCCTGTGAGG + Intergenic
1067619634 10:47872280-47872302 GGGAGGTGTTGAGCTCTGCATGG - Intergenic
1067711861 10:48656353-48656375 GGGCGAGGCTGACCCCTGCCGGG + Intergenic
1068555336 10:58452625-58452647 GGGCTGTGCTTAGTCCTGCCTGG + Intergenic
1069826323 10:71257164-71257186 GGGCTCTGCTGGGCCCTGAGGGG + Intronic
1069893977 10:71669092-71669114 GGACAGTGCTGAGCGCTGAGCGG + Intronic
1069956797 10:72057018-72057040 GGACGGTGCTGTGCCCAGGGAGG + Intergenic
1076337819 10:129720384-129720406 GGGCTGTGCTGAGCCAGGAGGGG - Intronic
1077024373 11:432760-432782 GGCCCTGGCTGAGCCCTGCGGGG + Intronic
1077140747 11:1023820-1023842 GCGCCGGGCTGTGCCCTGCGGGG - Intronic
1077192840 11:1262621-1262643 GGCTGGTGCTGGGCCCTGCGGGG + Intergenic
1077334659 11:1997944-1997966 GGGCGGAGGTGGGCCCTGCGGGG - Intergenic
1078051785 11:7971746-7971768 GGGTGGTGCTGTGGCCTGCTCGG + Intronic
1078413455 11:11146769-11146791 GGGAGGTGGTGAGCCCAGTGGGG + Intergenic
1080851409 11:36073434-36073456 GGGCGCTGCTGAGTTCTACGAGG + Intronic
1081488283 11:43547965-43547987 GGGCGGTGCGCAGCGGTGCGGGG + Intergenic
1081811873 11:45918713-45918735 GGGCGCAGCTGAGGACTGCGAGG - Intronic
1083968855 11:66060017-66060039 GGGCAGGTCTGAGCCCTGCCAGG - Intronic
1084053419 11:66616132-66616154 GGACTGTGCTGAGCACCGCGAGG - Intergenic
1084183530 11:67458341-67458363 GGGAGGGGCTGAGCTTTGCGGGG + Intronic
1084410193 11:69002411-69002433 GGGAGGAGCTGAGGGCTGCGGGG - Intergenic
1084517479 11:69644559-69644581 GGGCTCAGCTGAGCCCTGAGGGG + Intronic
1084888467 11:72224959-72224981 GGGCGGTGCTGAGCCCTGCGCGG + Exonic
1085619031 11:78023321-78023343 GGACGGGGCTGAGCCAGGCGTGG + Intronic
1088786034 11:113182679-113182701 GGGCGGTGCTGTGTTCTGGGTGG + Intronic
1089611741 11:119673101-119673123 GGGCATGGCTGTGCCCTGCGGGG + Intronic
1090242522 11:125194138-125194160 GGTCTCTGCTGAGCCCTGTGTGG + Intronic
1090806552 11:130206233-130206255 GGGCGGTGCTGTACCCTACTCGG + Intronic
1090917394 11:131177593-131177615 GGGAAGTGCTGGGCCCAGCGTGG + Intergenic
1091293441 11:134455455-134455477 GGGCCTTGCTGAGACCTGCTGGG + Intergenic
1202817642 11_KI270721v1_random:53126-53148 GGGCGGAGGTGGGCCCTGCGGGG - Intergenic
1091866236 12:3839340-3839362 GGGCGGCGCGGGGCCCCGCGAGG + Intronic
1093464954 12:19439789-19439811 GGGCCGGGCTGAGCCCCCCGAGG + Exonic
1094734877 12:33223085-33223107 TGTCGGACCTGAGCCCTGCGGGG - Intergenic
1096482372 12:51951452-51951474 GATCGGTGCCGAGCCCGGCGCGG - Intergenic
1096980358 12:55725109-55725131 GGGAGGTGCTGGGCCCTTAGCGG + Intergenic
1100738627 12:97566271-97566293 GGGAGCTGCTGAGCCCTTCTTGG - Intergenic
1101641104 12:106586287-106586309 AGTGGGTGCTGAGCCCCGCGTGG + Intronic
1102304066 12:111791564-111791586 GGGCAGGGTTGAGCCCTTCGTGG + Intronic
1102651215 12:114443914-114443936 TGGCGCTGATGAGCGCTGCGCGG + Intergenic
1104848306 12:131858199-131858221 GGGCGGTGCTGGGTGCTGTGGGG + Intergenic
1105608581 13:21947693-21947715 GGGTGGTGCTGGGCACTGGGTGG + Intergenic
1113847633 13:113401662-113401684 GGGCTGTGCTGAGCTCTGGGGGG - Intergenic
1114674611 14:24431892-24431914 GGGCGGAGCTCAGCCTTGCTGGG + Exonic
1119433243 14:74581948-74581970 AGGCAGTGCTGAGCCCTGAGTGG - Intronic
1121343031 14:93116164-93116186 TGGGGGTGCTGAACCCTGCTGGG - Intronic
1121449241 14:93996934-93996956 GGGTGGGGCTGAGCCTTGGGGGG + Intergenic
1122272041 14:100572615-100572637 GGGCAGAGATGAGCCCTGGGGGG + Intronic
1122620948 14:103057440-103057462 GGGCGGGGCTGAGGGCGGCGGGG - Exonic
1122899258 14:104775441-104775463 TGGGGTTGCTGAGCCCTGCCAGG - Intronic
1123089930 14:105737963-105737985 GGGCAGGGCTGTGGCCTGCGTGG - Intergenic
1124125878 15:26937782-26937804 GGGCTGGCCTGAGCCCTGCAGGG + Intronic
1124372721 15:29112522-29112544 AGACTGTGCTGAGCCCTGGGAGG - Intronic
1125759738 15:42088439-42088461 GGGCGTGGCTGAGGCCTGCTGGG + Intronic
1126103547 15:45133986-45134008 GGGGGGTACTGAGTGCTGCGGGG + Intronic
1128380254 15:67107089-67107111 GTACTGTGCTGAGCCCTGGGTGG - Intronic
1128762014 15:70223514-70223536 GAGAGGTGCTGAGGCCTGAGGGG - Intergenic
1132583437 16:695370-695392 GGGCGGGGCTGGGCCGGGCGGGG - Intronic
1132747688 16:1443781-1443803 GAGCAGTGGTGAGCCCTGCAGGG - Exonic
1132764502 16:1527347-1527369 GGGCTCTGCAGAACCCTGCGTGG - Intronic
1132889547 16:2196927-2196949 GCGCGGGGCTGAGCCCAGAGAGG + Intergenic
1132903010 16:2268487-2268509 GGGCTGTGCTGAGGCCGGCGGGG + Intergenic
1136294610 16:29294578-29294600 TGGCGGTGCCAACCCCTGCGGGG - Intergenic
1138646966 16:58432598-58432620 GGACGGTGATGAGCCCAGAGTGG + Intergenic
1140209479 16:72959464-72959486 GGACGGGGCTGAGCCCCGCCAGG + Exonic
1142030524 16:87836195-87836217 GGGCGGTGGTGAGCCCCGGCAGG - Intronic
1142111157 16:88332428-88332450 TGGCGGTGCTCAGCACTGCCAGG - Intergenic
1142207856 16:88792494-88792516 GTGAGGCGCAGAGCCCTGCGTGG + Intergenic
1142246093 16:88970747-88970769 GGAGGGTGCTGAGCCCTGGAAGG - Intronic
1142363252 16:89637071-89637093 GGTGGGTGCTGAGCCCTGAGTGG + Intronic
1143012243 17:3872421-3872443 TGGCGGTGCTGTTCCCTGGGAGG - Intronic
1143635780 17:8163062-8163084 GGGCGCTGCGGGGCGCTGCGGGG + Intronic
1143873501 17:9974833-9974855 GGGTGGGGGTGAGCCCTGGGTGG - Intronic
1145018944 17:19415398-19415420 GGGCTGTGCCGAGGCCTCCGGGG + Intronic
1145960718 17:28885182-28885204 GGGAGGTGCAGAGGCCTGGGAGG - Intronic
1147214310 17:38890515-38890537 GGGCGGTGCTGGGGCCTGGCAGG + Intronic
1147263371 17:39221697-39221719 CTGCTGTGCTGAGCCCTGCATGG + Intronic
1147922559 17:43927085-43927107 GGGCGGGGCTGACATCTGCGAGG + Intergenic
1147994545 17:44353707-44353729 GGGCGGTGCCAGGCCCTGCGCGG + Exonic
1148551321 17:48552199-48552221 GGGCGGGGGTGAGCCAGGCGGGG + Exonic
1150301232 17:64048916-64048938 TGGAGGTCCTGAGGCCTGCGGGG + Intronic
1151360970 17:73588664-73588686 AGGCTGTCCTGAGCACTGCGGGG - Intronic
1151481104 17:74370451-74370473 GGGCGGGGCTGCGCCCAGCCAGG + Intronic
1151658043 17:75504774-75504796 GGGCAGTGCTGGGCACTGTGTGG - Intronic
1152135300 17:78499991-78500013 GGGAGGTGCTCACCCCTGTGCGG + Intronic
1152689523 17:81711860-81711882 GGCCGGGGCTGAGCCCTCGGTGG + Intergenic
1152727737 17:81955930-81955952 GGAGGGTGCTGAGCTCTGCCTGG - Intronic
1152757592 17:82093405-82093427 GTGCGATGCTGGGCCCTGCAAGG + Exonic
1154161075 18:11981336-11981358 GGGCGGGGCCGAGCTCTGCGAGG + Intronic
1156462720 18:37330630-37330652 GGGCCATGCTGGGCCCTGCGTGG - Intronic
1160054199 18:75464213-75464235 GGGCTGTGCAGAGTCCTGCGAGG - Intergenic
1160528848 18:79552138-79552160 AGCCGGTGCTGAGCTCTGCGGGG + Intergenic
1160566368 18:79788726-79788748 GGGCGGGGCGGTTCCCTGCGCGG - Intergenic
1160779689 19:872301-872323 GGGCTGTCCTGGGCCCTGCAGGG - Intronic
1160799258 19:960248-960270 GGGCGGTGGTGAGCACCCCGTGG + Intronic
1160811627 19:1015362-1015384 GGGCCGTCCTGGGCACTGCGGGG - Intronic
1161138431 19:2634267-2634289 GGGCCGTCCTGGGCACTGCGGGG + Intronic
1161141995 19:2653624-2653646 GGGCTGTCCTGGGCACTGCGGGG + Intronic
1161144688 19:2670680-2670702 GGGCTGTGCTGGGCACTGCAGGG + Intronic
1161265808 19:3363836-3363858 GGGCCGTCCTGGGCCCTGCAGGG - Intronic
1161322475 19:3647568-3647590 GGGCCGTCCTGGGCCCTGCAGGG - Intronic
1161461322 19:4399604-4399626 GGGCCGTCCTGGGCACTGCGGGG - Intronic
1161499747 19:4607317-4607339 GCGCTGGGCTGAGCCCGGCGCGG + Intergenic
1161517917 19:4706905-4706927 GGGCTGTCCTGACCACTGCGAGG + Intronic
1161564960 19:4996877-4996899 GGGCTGTCCTGGGCCCTGCAGGG + Intronic
1161575841 19:5053825-5053847 GGCTGGTGCTGAGCGCTGCTGGG - Intronic
1161591797 19:5132293-5132315 GGCCTGTGCTCAGCCCTGGGAGG - Intronic
1161609113 19:5231260-5231282 GGGCCGGGCTGGGGCCTGCGGGG + Intronic
1161745664 19:6058182-6058204 GGGCCGTCCTGAGCACTGCAGGG + Intronic
1161850740 19:6736950-6736972 GGGCGGTGCTCACCCCAGTGGGG - Intronic
1161988484 19:7670464-7670486 GAGCGGATCTGAGCCCTGCGTGG + Intergenic
1163557233 19:17999698-17999720 GGCAGATGCTGAGCCCTGGGTGG + Exonic
1164388058 19:27793830-27793852 GGGCGGTGCGGATCCCTGGAGGG + Intergenic
1165145060 19:33725453-33725475 GGTCCCTGCTGAGCCCTGCGTGG + Intronic
1165323154 19:35098760-35098782 TGGTGGCGCTGAGCCCTGCCAGG + Intergenic
1165420099 19:35718186-35718208 GGGCGGAGCCGAGCCCGGGGAGG + Exonic
1165672631 19:37692424-37692446 GCGAGGTGCTCAGCCCTGGGAGG + Intronic
1166047696 19:40239015-40239037 GGGCTCTGCTGAGCCATGCCAGG + Intronic
1167237016 19:48321386-48321408 GGGCGGGGCTGAGACCTGTGAGG + Intronic
1167376569 19:49115150-49115172 GGGCGGGGCGGATCCTTGCGTGG + Intronic
1167521418 19:49958352-49958374 GGCCGGAGCTGAGCCCTCCATGG + Exonic
1167756107 19:51414890-51414912 GGCCGGAGCTGAGCCCTCCATGG + Exonic
1167784692 19:51627528-51627550 GGTCGGAGCTGAGCCCCCCGTGG + Exonic
925009219 2:469155-469177 GGGCGGAGCTGGGGCCTGGGAGG + Intergenic
925351496 2:3204029-3204051 GGGCCGTGCTGAGCACTTTGAGG + Intronic
927042049 2:19239820-19239842 GGCCTGTGCTCAGCCCTGTGGGG - Intergenic
932036360 2:68251523-68251545 CTGCGGTGCGCAGCCCTGCGGGG - Intronic
933769952 2:85737173-85737195 GGGCGGGGCTGAGGCAAGCGAGG - Intergenic
934158942 2:89230074-89230096 GGTCAGTGCTCAGCCCTGCAGGG - Intergenic
934208333 2:89952354-89952376 GGTCAGTGCTCAGCCCTGCAGGG + Intergenic
938367344 2:130745146-130745168 GGTGGGTGAGGAGCCCTGCGGGG - Intergenic
940038018 2:149330434-149330456 GGGGGGAGCGGAGCCCTCCGCGG - Intronic
942324665 2:174765772-174765794 GGGCGGGGCTGAGCTCTGGTAGG - Intergenic
944221750 2:197310514-197310536 GGGCGGCGCGGAGCCCGGCGGGG - Intronic
946360699 2:219217989-219218011 GGGAGGGGCTGAGTCCTGCCGGG - Intronic
946619523 2:221545984-221546006 GGGAGATGCTGAGTCCTGCTGGG - Intronic
947518741 2:230828489-230828511 GCGCTGGGCTGAGCCCTGGGTGG - Intergenic
947743303 2:232494783-232494805 GGGAGGTGCTCAGGCCTGCCAGG + Intergenic
948747578 2:240107503-240107525 GTGCAGTGCCCAGCCCTGCGTGG + Intergenic
948805687 2:240452732-240452754 GGGCGGTGCCGAGCGCGGCGGGG + Intronic
948826086 2:240574013-240574035 GGGCTGGGCTGATCCCTGCTGGG + Intronic
948990505 2:241551652-241551674 GGGCTGTGGTGAGCCCTGAGTGG - Intergenic
1168750729 20:279355-279377 AGGCGGCGCTGCGCCCTGCCCGG + Intronic
1169845119 20:9981885-9981907 GGGAGCTGCTGAGCCCAGAGTGG + Intergenic
1174406276 20:50305335-50305357 GGGTGGTGCTGGGCCTTGTGGGG - Intergenic
1175154328 20:56959467-56959489 GGGCTGTGCTGTGCACTGTGGGG + Intergenic
1175666965 20:60869261-60869283 AGGCTGTGCTGAGCTCTGTGCGG + Intergenic
1175774455 20:61644354-61644376 GGGCTGCGCAGAGCCCTTCGAGG + Intronic
1175852310 20:62100147-62100169 GTGCGCTGCTCAGGCCTGCGTGG - Intergenic
1176170993 20:63696343-63696365 GGGCAGGGCTGAGCCCACCGTGG - Intronic
1176171893 20:63699872-63699894 GGACAGGGCTGAGGCCTGCGGGG - Exonic
1176216736 20:63951639-63951661 GTGCTCTGCTGAGCCCTGGGTGG - Intronic
1176216750 20:63951681-63951703 GTGCCCTGCTGAGCCCTGGGCGG - Intronic
1176216764 20:63951723-63951745 GTGCCCTGCTGAGCCCTGGGCGG - Intronic
1176216778 20:63951765-63951787 GTGCCCTGCTGAGCCCTGGGCGG - Intronic
1176297365 21:5081265-5081287 GGACGGGGATGAGCTCTGCGGGG - Intergenic
1176842278 21:13850686-13850708 GGGGGCTGCTGAGCACTGCAGGG - Intergenic
1178485025 21:33013686-33013708 GGGCGGTGCAGAGCCCTTGGAGG - Intergenic
1179396809 21:41047485-41047507 GGGCAGTGCTGTGCCCTGATTGG - Intergenic
1179600344 21:42473786-42473808 GGGCTGTTCTGTGCCCTGCAGGG + Intronic
1179663416 21:42893039-42893061 GGGCGCGGCGGAGACCTGCGGGG - Intronic
1179713938 21:43278225-43278247 GGGCGGTGCTGGGCGGTGCTGGG + Intergenic
1179859664 21:44180683-44180705 GGACGGGGATGAGCTCTGCGGGG + Intergenic
1179884051 21:44305962-44305984 GGGCAGTGCTGTTCCCTGGGTGG + Intronic
1180825156 22:18856567-18856589 GGGTGCTGCTGACCCCTGCGAGG - Intronic
1180874212 22:19167299-19167321 CGGTGGTGCTGAGCCCTGAACGG + Intergenic
1181187574 22:21117980-21118002 GGGTGCTGCTGACCCCTGCGAGG + Intergenic
1181211624 22:21292513-21292535 GGGTGCTGCTGACCCCTGCGAGG - Intergenic
1181276181 22:21688624-21688646 GGGCCTTGCTGAGCCCAGCCTGG - Intronic
1181397882 22:22634373-22634395 AGGTGCTGCTGACCCCTGCGAGG + Intergenic
1181458237 22:23071292-23071314 GGGCGGTGCTGAGCCTTCCTGGG + Intronic
1181500627 22:23313744-23313766 GGGTGCTGCTGACCCCTGCGAGG + Intronic
1181623358 22:24105906-24105928 GGCCTGTGCTGAGCCCTCAGAGG - Intronic
1181651524 22:24261685-24261707 GGGTGCTGCTGAGCCCTGCGAGG - Intergenic
1181705851 22:24649054-24649076 GGGTGCTGCTGACCCCTGCGAGG + Intergenic
1181810066 22:25398571-25398593 GCGGGGCTCTGAGCCCTGCGGGG + Intronic
1182509613 22:30809584-30809606 GGGGAGTGCTGAGCCCTACAAGG + Intronic
1184686072 22:46096904-46096926 GTGGGATGCTGAGCCCTGAGTGG - Intronic
1184843202 22:47064592-47064614 GGGCAGTGCTGAGCACGGCTGGG - Intronic
1184877484 22:47284657-47284679 GCGCCAGGCTGAGCCCTGCGTGG + Intergenic
1185246918 22:49777628-49777650 GGGCGGTGCTGGGAGCTGCGTGG + Intronic
1203215329 22_KI270731v1_random:2919-2941 GGGTGCTGCTGACACCTGCGAGG + Intergenic
1203275301 22_KI270734v1_random:82470-82492 GGGTGCTGCTGACCCCTGCGAGG - Intergenic
949234705 3:1793976-1793998 GGGCTGTGCTGTGCCATGAGAGG - Intergenic
949710493 3:6864740-6864762 GGGGGGTGCTGAGCACTGAAGGG + Intronic
950677390 3:14562759-14562781 GGGCGATGCTGAGACCTGTCCGG - Intergenic
952832218 3:37574784-37574806 GGGCTGTGCTCAGCCCTTCCGGG + Intronic
953910081 3:46888361-46888383 GGAGGGTGCCGAGCCCTCCGAGG + Intronic
953970480 3:47343469-47343491 GGGGGCTGCTGTGCCCTGCACGG + Intronic
954439197 3:50512272-50512294 TGGCCTTGCTGAGCCCTGCTTGG + Intergenic
955687498 3:61561852-61561874 CGGCGGGGCTGAGCGCGGCGCGG - Intronic
957995021 3:87678950-87678972 GGGAGGTGCTGAGAGCAGCGAGG - Intergenic
960986923 3:123286795-123286817 GGCCGATGTTGAGCCCTGCAGGG + Exonic
962351571 3:134660215-134660237 GGGCAGAGCAGAGCCCTGTGGGG - Intronic
968289209 3:197525806-197525828 GGGAGGTGGTGTGGCCTGCGGGG - Intronic
968350251 3:198047241-198047263 GGGGGGTGATGAGCGCTGCTGGG - Intergenic
968451678 4:678901-678923 GGGCGGGGCAGAGCCCAGCCGGG + Intronic
968525177 4:1053210-1053232 AGACTGAGCTGAGCCCTGCGAGG + Intergenic
968542250 4:1173448-1173470 GTGCGGTGCAGAGCCCTCCCAGG + Intronic
968576964 4:1371386-1371408 GGGCGGTGCTGATTCTTGGGAGG + Intronic
969360315 4:6659003-6659025 GGGTGGAGCTGAGACCGGCGGGG + Intergenic
969631436 4:8340917-8340939 TGCCGGTGCTCAGCCCTGCGTGG + Intergenic
981475042 4:145179913-145179935 GGGCGGCGCGGGGCCCCGCGAGG - Intronic
981615613 4:146640265-146640287 GGGCCATGCTGAGCGCTGCTTGG - Exonic
985665604 5:1180346-1180368 GGGCAGTGCTGCCCCCAGCGGGG + Intergenic
985748883 5:1663345-1663367 GGGCGGGGCTGAGACCTGGAGGG + Intergenic
988020030 5:25609857-25609879 GGGCAGTGCTGAGCCCTCACAGG + Intergenic
997727299 5:136132698-136132720 GGCCGGCGCGGAGCCCGGCGCGG + Intergenic
998142773 5:139709498-139709520 GGGCTGTGCAGGGCCCGGCGGGG + Intergenic
998374583 5:141682265-141682287 GGGCGGGGCTGGGCCCGTCGAGG - Intergenic
999147687 5:149406795-149406817 GGCGGGTGCTGAGCCCTCCCAGG - Intergenic
999399390 5:151252926-151252948 GGGCGGAACTGAGCGCGGCGGGG - Exonic
1001315084 5:170636302-170636324 GAGCAGAGCTGAGCCCTGAGGGG + Intronic
1001399335 5:171437404-171437426 GGGCAGGGCTGAGCCATGCTGGG + Intronic
1001799142 5:174528272-174528294 GGGGGTTGCTGAGGCCAGCGTGG + Intergenic
1002076504 5:176711818-176711840 GGGGGGCGCAGAGCCCTGCCGGG - Intergenic
1002271101 5:178072949-178072971 TGGTGGTGCTGAGTCTTGCGTGG - Intergenic
1002762021 6:209672-209694 GGCCGTTCCAGAGCCCTGCGTGG + Intergenic
1002788799 6:423950-423972 AGGAGGTGCTGGGCCCTGCTGGG + Intergenic
1002792709 6:447520-447542 GGGCAATGCTGCGCGCTGCGTGG - Intergenic
1003016286 6:2470005-2470027 TGGCTGTGCTGAGACCTGCCAGG + Intergenic
1005746094 6:28838977-28838999 CCGGGGTGCTGAGCCCAGCGAGG + Intergenic
1007088901 6:39169674-39169696 GGCCAGTCCTGAGCCCTGGGGGG + Intergenic
1007957214 6:45929098-45929120 GGGGAGAGCTGGGCCCTGCGTGG - Intronic
1011666342 6:89638511-89638533 GGGCGGTGCTTCGCTCCGCGGGG - Intronic
1013677974 6:112488251-112488273 GGGAAGGGTTGAGCCCTGCGAGG + Intergenic
1015446845 6:133316043-133316065 AGGTGGTGCTGAGCCCAGCCAGG - Intronic
1017393855 6:153973333-153973355 GGGTGGTGCTGGGCCCTGATTGG + Intergenic
1018891456 6:167986055-167986077 GGACGGGGCAGAGGCCTGCGAGG - Intergenic
1019134357 6:169899071-169899093 GGGCGGGGCGGGGCGCTGCGTGG - Intergenic
1019500427 7:1361872-1361894 GGCTGGTGCTGAGACCTGCCCGG + Intergenic
1019603181 7:1895453-1895475 AGGCGGGGCTGAGAGCTGCGGGG - Intronic
1019709250 7:2510864-2510886 GGGCGGCCCTCAGCCCTGCCCGG + Intergenic
1019743788 7:2688494-2688516 GGGCTGTGCGGACCCCGGCGCGG - Intronic
1020274446 7:6615870-6615892 GGCCGGCCCTGAGCCCCGCGCGG + Exonic
1021340506 7:19457869-19457891 GGGAGGTGCTTTGCCCTCCGTGG - Intergenic
1021566884 7:22024923-22024945 GGGCAGTGCTGAGCACAGCATGG - Intergenic
1021600275 7:22357210-22357232 GCGCGGGGCTGAGCCTCGCGGGG - Intergenic
1024686742 7:51754074-51754096 TGCCAATGCTGAGCCCTGCGGGG - Intergenic
1025789114 7:64671331-64671353 GGGCGGTGCCTAGTCCTGGGAGG - Intronic
1026941615 7:74290508-74290530 GGGTGGGGCTGGGGCCTGCGTGG - Intronic
1027190609 7:75993929-75993951 GGGCGGGGCTAGGCCCTGCAGGG - Intronic
1028621917 7:92835366-92835388 GGGCAGTGCGGGGCCCGGCGGGG - Intronic
1031574001 7:123393818-123393840 GAGCAGAGCTGAGCCCTGTGTGG - Intergenic
1032241365 7:130161878-130161900 GGTCGCTGCTGTCCCCTGCGGGG + Intergenic
1032581346 7:133106080-133106102 GGGAGGAGCTGAGCACTGTGTGG - Intergenic
1034313626 7:150110877-150110899 GGGCGGGGCTGGCCACTGCGAGG + Intergenic
1034793272 7:153989919-153989941 GGGCGGGGCTGGCCACTGCGAGG - Intronic
1035379788 7:158430494-158430516 GTGCCGCGCTGAGCCGTGCGAGG - Intronic
1035552171 8:537152-537174 GGGCACTGCTGAGCCCCACGTGG + Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1035890854 8:3341147-3341169 GGGCGAGGCTCAGCCCTGCCTGG - Intronic
1036103101 8:5809193-5809215 GGGAGGTGCTCACCTCTGCGAGG - Intergenic
1036432116 8:8701635-8701657 GGGCGGTGCCGAGCGCTCCCGGG - Intergenic
1036621185 8:10425272-10425294 GGGCGGTGCAGAGGCGTGGGTGG + Intronic
1038427297 8:27472090-27472112 GAGGGGTGATGAGCCCAGCGAGG + Intronic
1040471391 8:47738162-47738184 CGGCGGGGCTGGGCCCAGCGAGG - Exonic
1045259435 8:100559472-100559494 GGGCCGGGCAGAGGCCTGCGAGG - Intronic
1047502744 8:125454599-125454621 GGACGGAGCTGGGCCCTGCCTGG + Intergenic
1048553916 8:135457392-135457414 GGGCGGGGCGGAGCCGGGCGGGG + Intergenic
1049519857 8:143082580-143082602 GAGGGGCGCTGGGCCCTGCGAGG + Exonic
1049593223 8:143471981-143472003 GGGCTGTGCAGAGCCCAGTGAGG - Intronic
1049651252 8:143771061-143771083 GGGCTGTGATGAGCCCTCCCAGG + Intergenic
1049657425 8:143804966-143804988 GGGCGGTGCTGCTCACCGCGCGG - Exonic
1049693917 8:143974532-143974554 GCCAGGTGCTGAGCCCTGGGGGG - Intronic
1049720412 8:144112965-144112987 GGGAGGGGCTGAGGCCTGCCTGG - Intronic
1049861619 8:144902440-144902462 GGGCGGGGCTGGGGGCTGCGTGG + Intergenic
1052880482 9:33598578-33598600 GGGGGCTGCTGAGCACTGCTGGG + Intergenic
1055985733 9:82055666-82055688 GGGGGCTGCTGAGCACTGCTGGG + Intergenic
1056199179 9:84258012-84258034 GGCCGATGCTGAGTCCTGGGTGG + Intergenic
1056585606 9:87925453-87925475 GGGGGCTGCTGAGCACTGCTGGG - Intergenic
1056611273 9:88127491-88127513 GGGGGCTGCTGAGCACTGCTGGG + Intergenic
1056761151 9:89415800-89415822 GTCCGGTGCTGAGCTCTGCTGGG - Intronic
1056825517 9:89873975-89873997 GGGCAGTGCTGAGCCAAGCATGG + Intergenic
1057187404 9:93064654-93064676 GTGTTGTGCTGAGCCCTGTGGGG - Intronic
1057228306 9:93304044-93304066 GGGCAGTATTGAGCCCTGTGAGG + Intronic
1057257969 9:93566644-93566666 GGGCGGGGCGGGGCCTTGCGTGG + Intergenic
1057309518 9:93933359-93933381 TGGCGGAGCTGAGCCCCACGTGG + Intergenic
1057675383 9:97132991-97133013 GGGGGCTGCTGAGCACTGCTGGG - Intergenic
1057727581 9:97579017-97579039 GGGCTGTGCTGAGTCCTCCAAGG + Intronic
1060139942 9:121201422-121201444 GGGCGGAGGTGTCCCCTGCGCGG - Intronic
1060981501 9:127794888-127794910 GTGCTGCGCTGAGCCCTGTGAGG - Intronic
1061263986 9:129495249-129495271 GGGCTGGACTGAGCCCAGCGAGG - Intergenic
1061503899 9:131019884-131019906 GGGCGGTGCGGGGCCCGGCCGGG - Intronic
1061612389 9:131755788-131755810 TGGCGCTGTGGAGCCCTGCGTGG + Intergenic
1061922143 9:133788124-133788146 GGGGGGCGCTGGGCCCGGCGAGG + Intronic
1062035967 9:134382669-134382691 GTGGGGTGCTGAGGCCTGAGTGG + Intronic
1062394625 9:136347862-136347884 GGGTGTCGCTCAGCCCTGCGGGG - Intronic
1062398010 9:136360305-136360327 GCGCGGTCCTGGGCCCTGCACGG - Intronic
1185643349 X:1600356-1600378 GGGCAGAGCCGAGCCCTGCCGGG - Intronic
1187403718 X:18984356-18984378 GGGCGGGGCTGAGCGCGGCCTGG - Exonic
1188811300 X:34656901-34656923 GGGCGGTGCTGAGCCCGGCCTGG - Exonic
1189002089 X:36958020-36958042 GGGCGGTGCTGAGCCCGGCCTGG + Intergenic
1189005000 X:36985935-36985957 GGGCGGCGCCGAGGCCTGAGGGG - Intergenic
1189282520 X:39828799-39828821 GGGAGCTGCTGAGCCCTGCCTGG + Intergenic
1190286675 X:48966151-48966173 GCGCGGCGCTTGGCCCTGCGAGG + Exonic
1192363910 X:70455439-70455461 AGGGGGCGCTGAGCCCCGCGCGG - Intronic
1197147085 X:123183380-123183402 GGGCGGTGCTGAGCAGTGATGGG - Intergenic
1198099932 X:133414908-133414930 GCGCGGCGCTGAGCACTGCCAGG + Exonic
1199867112 X:151861764-151861786 GGGCTGTGCTGAGGCCAGGGAGG - Intergenic