ID: 1084889736

View in Genome Browser
Species Human (GRCh38)
Location 11:72230780-72230802
Sequence GCTGCTGTTCCCCCAGAAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 242}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084889731_1084889736 -10 Left 1084889731 11:72230767-72230789 CCGCCCCTGAGTGGCTGCTGTTC 0: 1
1: 1
2: 2
3: 19
4: 209
Right 1084889736 11:72230780-72230802 GCTGCTGTTCCCCCAGAAGCGGG 0: 1
1: 0
2: 0
3: 44
4: 242
1084889730_1084889736 -9 Left 1084889730 11:72230766-72230788 CCCGCCCCTGAGTGGCTGCTGTT 0: 1
1: 0
2: 3
3: 35
4: 365
Right 1084889736 11:72230780-72230802 GCTGCTGTTCCCCCAGAAGCGGG 0: 1
1: 0
2: 0
3: 44
4: 242
1084889724_1084889736 22 Left 1084889724 11:72230735-72230757 CCCTGTGGACGGGGGGCTTCCTG 0: 1
1: 0
2: 2
3: 26
4: 186
Right 1084889736 11:72230780-72230802 GCTGCTGTTCCCCCAGAAGCGGG 0: 1
1: 0
2: 0
3: 44
4: 242
1084889729_1084889736 -5 Left 1084889729 11:72230762-72230784 CCTACCCGCCCCTGAGTGGCTGC 0: 1
1: 0
2: 2
3: 20
4: 198
Right 1084889736 11:72230780-72230802 GCTGCTGTTCCCCCAGAAGCGGG 0: 1
1: 0
2: 0
3: 44
4: 242
1084889725_1084889736 21 Left 1084889725 11:72230736-72230758 CCTGTGGACGGGGGGCTTCCTGG 0: 1
1: 0
2: 1
3: 20
4: 206
Right 1084889736 11:72230780-72230802 GCTGCTGTTCCCCCAGAAGCGGG 0: 1
1: 0
2: 0
3: 44
4: 242
1084889727_1084889736 3 Left 1084889727 11:72230754-72230776 CCTGGATGCCTACCCGCCCCTGA 0: 1
1: 0
2: 1
3: 6
4: 118
Right 1084889736 11:72230780-72230802 GCTGCTGTTCCCCCAGAAGCGGG 0: 1
1: 0
2: 0
3: 44
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084889736 Original CRISPR GCTGCTGTTCCCCCAGAAGC GGG Exonic
900289069 1:1916179-1916201 GCTGCTGTTCCCTCGCACGCTGG + Intronic
900536085 1:3178471-3178493 GCTGCTGTTCTCCCGGAGGCCGG + Intronic
900578520 1:3395989-3396011 GCTGCGGTTCTCCCAGGAGCGGG - Intronic
900737505 1:4308425-4308447 GCTGCTCTTTCCCCAGCACCCGG - Intergenic
901206499 1:7500599-7500621 GCTGCTGCTGCTACAGAAGCGGG - Intronic
901303664 1:8217314-8217336 GCGGCCGCTCCCCCACAAGCTGG - Intergenic
901432408 1:9225144-9225166 GCTGCTGTGCCCCCTGAGCCTGG + Intergenic
901752398 1:11418716-11418738 GCTCCTGCTCCCCCAGAGCCAGG + Intergenic
902394759 1:16126511-16126533 GCTGGTGCTCCCACAGCAGCAGG + Intronic
902626623 1:17680250-17680272 CCTGCTGTTTCCTCAGGAGCTGG + Intronic
903299380 1:22367466-22367488 GCTGCTGTGCCCACTGAAGTGGG + Intergenic
904330472 1:29755121-29755143 GCTGCTGTTGGCCCTCAAGCAGG + Intergenic
904625145 1:31798236-31798258 GCAGCTGGCCCCCCAGGAGCTGG - Exonic
905340828 1:37276148-37276170 GCTGCTGCTCCACCAGGAGACGG + Intergenic
905371215 1:37483545-37483567 GCTCCTGGACCCCCAGCAGCTGG + Exonic
905938226 1:41841585-41841607 TGTGCTGTTCTTCCAGAAGCTGG + Intronic
907908345 1:58805570-58805592 TCTGCTGTGTCCCCAGAACCTGG + Intergenic
908995519 1:70148051-70148073 TCTGCTGTTCCCTCAGCATCAGG - Intronic
913179991 1:116311851-116311873 ACAGGTGTTCCCACAGAAGCTGG - Intergenic
913269107 1:117075551-117075573 GCCGCTGGTCCTCCAGGAGCAGG - Exonic
915251774 1:154595133-154595155 GCTGCTGATCCCACAGGAGGCGG - Intronic
916335324 1:163664699-163664721 ACTACTGTTCTCCCAGAAGTTGG - Intergenic
916344131 1:163769343-163769365 GCTGTGCTACCCCCAGAAGCAGG + Intergenic
917456940 1:175193270-175193292 GCAGCTGTTTTCCCTGAAGCCGG - Intergenic
919807071 1:201386453-201386475 GCTGGGCTTCCCCCAGAGGCTGG + Exonic
919847161 1:201649403-201649425 GCTGCTCTTCAGCCAGATGCTGG + Exonic
921338050 1:214107890-214107912 GGAGCTGTTCTCCCAGGAGCTGG - Intergenic
921866752 1:220094438-220094460 GCTGCTGGGCCGCCAGCAGCCGG + Exonic
922220324 1:223553345-223553367 GCTGCTGGTCTCCCAGAGGGCGG + Intronic
923665013 1:235991952-235991974 GCTCCTTTTCCCTCAGAATCAGG + Intronic
924946052 1:248847697-248847719 GCTGCTCTTCCACCAGGCGCGGG + Exonic
1062990224 10:1807640-1807662 GCTAAGGTTACCCCAGAAGCTGG + Intergenic
1063060217 10:2543686-2543708 CCTGCTGTTCCCCATGTAGCAGG + Intergenic
1064229059 10:13513782-13513804 GCTGCAGCTCCCCGAGAGGCTGG + Intronic
1068692895 10:59935697-59935719 CCTGCCCTTCCCCCTGAAGCAGG - Intergenic
1069048629 10:63768916-63768938 GCTTCAGTTCCCCAAGTAGCTGG + Intergenic
1070155917 10:73835273-73835295 CCTGCTGTGCCCCTAGAAGTTGG - Intronic
1070525364 10:77291724-77291746 ACTCCTTTTCCCCCAGACGCTGG - Intronic
1070645075 10:78196192-78196214 ATTGCTGTGCCCCCAGAACCTGG + Intergenic
1072927326 10:99627553-99627575 GCTTCTGTCCCCCAAGTAGCTGG + Intergenic
1073074422 10:100814883-100814905 GAGGCTGGTCTCCCAGAAGCTGG + Intronic
1076701364 10:132274999-132275021 GGTGCTGGGCCCTCAGAAGCTGG - Intronic
1078615484 11:12861454-12861476 GCTGCTGTGGCCACGGAAGCCGG - Intronic
1079306919 11:19331417-19331439 TCTGCTCTTCCCTCAGAAGTTGG - Intergenic
1079493842 11:21018693-21018715 CCTGTTGTTTCCCCACAAGCTGG + Intronic
1080651030 11:34222870-34222892 TCTGTCGTTCCCCCAGAAACTGG - Intronic
1082735407 11:56849949-56849971 TCTACAGTTTCCCCAGAAGCTGG - Intergenic
1084038209 11:66526246-66526268 CCTCCTCTTTCCCCAGAAGCAGG - Intronic
1084295586 11:68211857-68211879 GCTGGAGTTCCCACACAAGCCGG + Intronic
1084557359 11:69883041-69883063 GCAGCTGGAGCCCCAGAAGCTGG - Intergenic
1084889736 11:72230780-72230802 GCTGCTGTTCCCCCAGAAGCGGG + Exonic
1085215029 11:74821946-74821968 GCTGCTATCCACCCAGAAGTTGG - Intronic
1085415894 11:76318795-76318817 GCTCCTCCTCCTCCAGAAGCAGG - Intergenic
1086900391 11:92361066-92361088 TCAGCTGTTCCCCCAGAGTCTGG - Intronic
1089302936 11:117509496-117509518 CCTGCCCATCCCCCAGAAGCAGG - Intronic
1091800789 12:3323354-3323376 GGTGCTGTTGCCCAGGAAGCCGG + Intergenic
1092200448 12:6579063-6579085 GCTGCTGTCTCCCAAGATGCTGG - Intronic
1092826362 12:12403490-12403512 GCTTCAGTTTCCTCAGAAGCAGG - Intronic
1096085195 12:48861017-48861039 GGAGCTGTCCCACCAGAAGCAGG - Exonic
1096523748 12:52198632-52198654 GCTCCTCTCCACCCAGAAGCAGG - Intergenic
1097895960 12:64825011-64825033 GCTGCTGTGCACCCTGGAGCCGG + Exonic
1098268850 12:68750727-68750749 GCTGCTGTGCCCCAAGGAGCAGG + Intronic
1098532347 12:71555250-71555272 GCTACTGACCCACCAGAAGCTGG + Intronic
1101490497 12:105205392-105205414 TCTGCTGTTCCCCCAGAACTGGG + Intronic
1101736865 12:107469625-107469647 GTTGAGGTTCCCCCAGCAGCAGG + Intronic
1104637671 12:130448254-130448276 GCTGGTGTGGCTCCAGAAGCGGG - Intronic
1104879776 12:132062512-132062534 GCTGCTGCTGCCTGAGAAGCTGG - Exonic
1104981856 12:132576804-132576826 GCAGCTGGACCCCCACAAGCTGG + Exonic
1105866205 13:24461760-24461782 GCTGCCCTTCCCCCAGCAGCTGG - Intronic
1106230491 13:27817498-27817520 GCAGCTATTCCCCAAGATGCTGG + Intergenic
1107087882 13:36445592-36445614 GCTGCTATTCCCTCTGAAACTGG - Intergenic
1110715641 13:78700869-78700891 GCTGCTGTTCCCTCAGAAAGTGG + Intergenic
1112460995 13:99603824-99603846 GCTGCTGTGCCCCCAGCACCTGG - Intergenic
1113466048 13:110513918-110513940 GCGCGTGTTCCCCCAGAAGCTGG + Intergenic
1113778768 13:112963833-112963855 AGTGCTGGCCCCCCAGAAGCTGG + Intronic
1114548991 14:23522608-23522630 GGTGCTGTTCCCCCAGCAGGGGG + Exonic
1116543659 14:46134888-46134910 CCTGCGGTCTCCCCAGAAGCTGG - Intergenic
1118009350 14:61593662-61593684 CCTGCTGTATCCCCAGAAGCAGG - Intronic
1118109886 14:62706790-62706812 GCAGCTGTTCTCCAAGAAGGAGG + Exonic
1118794553 14:69129431-69129453 GCTGCTTTTCACCCAGCAGAGGG + Intronic
1119605416 14:76012036-76012058 GCTGCATTGCCCCTAGAAGCTGG + Intronic
1120956988 14:90091572-90091594 GCAGCCTTTCCCCCAGAAACAGG - Intronic
1121838710 14:97115189-97115211 GCTGCTGCTCCCCCACCATCAGG - Intergenic
1122296128 14:100706614-100706636 GCTGCTGTTGCCCCCAAAGCTGG - Intergenic
1123439062 15:20276909-20276931 GGTTCTGCTCACCCAGAAGCCGG - Intergenic
1124627050 15:31314003-31314025 GCTGCTGTTGCCCCAGATTGGGG - Intergenic
1125215106 15:37263191-37263213 GATGCTTTTCCCCCAGATACTGG + Intergenic
1125579652 15:40776244-40776266 TCTGCTGTTCCTCCAGCTGCCGG + Exonic
1126260735 15:46687354-46687376 GCTGCTATTCCCCCTACAGCTGG - Intergenic
1127793075 15:62415590-62415612 GCTGCTGTTTCCCCAGAATGGGG - Intronic
1129034141 15:72639632-72639654 GCTACTGCTCCACCAGGAGCTGG - Intergenic
1129064370 15:72888934-72888956 GCTGCTGAGGCCTCAGAAGCAGG + Intergenic
1129215741 15:74097584-74097606 GCTACTGCTCCACCAGGAGCTGG + Intergenic
1129409061 15:75338852-75338874 GCTACTGCTCCACCAGGAGCTGG - Intronic
1129732876 15:77941912-77941934 GCTACTGCTCCACCAGGAGCTGG + Intergenic
1129775381 15:78233224-78233246 ACTCCTGTTCTTCCAGAAGCAGG - Intronic
1132803189 16:1764012-1764034 GTGGCTGTGCCGCCAGAAGCTGG + Intronic
1133788207 16:8989316-8989338 GTTGGTGTTTTCCCAGAAGCAGG + Intergenic
1135934480 16:26768109-26768131 GGTGCTGTTCCCCCATAGGAAGG - Intergenic
1136368597 16:29821481-29821503 GCCTCTGCTCCCCCAGAACCTGG - Intronic
1137654308 16:50147014-50147036 GTTGCTGTATCCCCAGAATCTGG + Intergenic
1138989498 16:62374277-62374299 TCTGCTCTTCCGCCATAAGCTGG + Intergenic
1139361395 16:66402342-66402364 GCTGCCGTTCCCCCACACCCAGG - Intronic
1140803435 16:78509983-78510005 GCTGCAGCATCCCCAGAAGCTGG - Intronic
1141105040 16:81226548-81226570 GCTTGGGTTCCCCCAGAAGTAGG - Intergenic
1141413579 16:83853197-83853219 GCAGCTGCCCTCCCAGAAGCAGG + Intergenic
1141616793 16:85214465-85214487 GTGGCTGAGCCCCCAGAAGCTGG + Intergenic
1143591163 17:7886355-7886377 CCTGCTGTTCCCCAAGCAGGGGG - Intronic
1144127918 17:12220184-12220206 GCTGCTGATCTCCTGGAAGCAGG + Intergenic
1144795481 17:17888552-17888574 GCTGCTGTCCACACAGAATCTGG + Intronic
1146353937 17:32118609-32118631 ACTGCGGCTCCCCTAGAAGCTGG + Intergenic
1147226573 17:38983302-38983324 GCTGCAATTCTCCCAGAAGGTGG + Intergenic
1147382920 17:40066082-40066104 GCAGCTGTGCCCTCAGAACCAGG - Intronic
1147861855 17:43528490-43528512 GCGGCTGTTCCCCCTGCCGCAGG - Exonic
1147903753 17:43808963-43808985 GCTGCTGTGTCCTCACAAGCTGG + Exonic
1148083125 17:44978362-44978384 GCTGCTGCTCTGCCAGAGGCTGG - Intergenic
1148483521 17:47975893-47975915 GCTGCGGTTCGTGCAGAAGCGGG + Exonic
1148751042 17:49946126-49946148 GCTGCTGTTCCTGCAGAGGAAGG + Intergenic
1150422203 17:65047739-65047761 CCTCCTGTCTCCCCAGAAGCTGG + Intronic
1150462092 17:65361656-65361678 GCAGCTGATCCCCCAGATGCTGG + Intergenic
1151244249 17:72782242-72782264 CTTGCTGCACCCCCAGAAGCTGG + Intronic
1151896370 17:76983331-76983353 TCTGCTCTTCCCCAGGAAGCAGG - Intergenic
1152248055 17:79196169-79196191 GCTGCTGTTTCTCCAGTAGAAGG - Intronic
1152626792 17:81391333-81391355 GCCCCTGTTCCCCCACAACCGGG - Intergenic
1154370387 18:13756138-13756160 GCTGCTGCTCCTCTAGAAGATGG + Intronic
1156460818 18:37320431-37320453 GCTGCTCTTCCGCCAGAGACAGG - Intronic
1157595062 18:48859358-48859380 GCAGCTGTTCCTCCAGCAGCCGG - Exonic
1158421850 18:57301907-57301929 GCTGCTGTGTCCCCAGAGGGTGG + Intergenic
1158689161 18:59644741-59644763 CCACCTGTTCCCCCAAAAGCTGG - Intronic
1159401276 18:67938610-67938632 GCTGCTTATTCCCCTGAAGCTGG + Intergenic
1160071800 18:75635429-75635451 GCTCCTCTGCCCCCAGAAGCTGG - Intergenic
1160345548 18:78129116-78129138 ACTGCTGGAGCCCCAGAAGCTGG + Intergenic
1160790951 19:923505-923527 GCTGCTGTGCCCCCAGGAGATGG + Intergenic
1160790964 19:923555-923577 GCTGCTGTGCCCCCGGTAGATGG + Intergenic
1161526491 19:4759355-4759377 GCTTCTTATGCCCCAGAAGCAGG - Intergenic
1161838624 19:6665046-6665068 GCTGCTGTCCCACCAGACCCGGG + Exonic
1162133211 19:8539994-8540016 GATGCTCTTCCCCGAGAAGCTGG - Exonic
1162828533 19:13269578-13269600 GCTGTTCTTCCCCCAAAGGCAGG - Intronic
1162937831 19:13990348-13990370 GCTGCTGGACCCCCTGCAGCTGG - Intronic
1163621551 19:18363800-18363822 GCAGCTGTGTCCCCAGATGCAGG - Exonic
1164892620 19:31837709-31837731 GCTTCTGTTTCCCCAGCAGTGGG - Intergenic
1165077277 19:33286867-33286889 GATGCTGAGGCCCCAGAAGCTGG + Intergenic
1165340500 19:35208420-35208442 ACTGCTGGTCCCCCAAAGGCGGG - Intergenic
1166159870 19:40944490-40944512 GATGGTGTACCCTCAGAAGCTGG - Intergenic
1166269630 19:41705996-41706018 GGTGCTGTGCCCCCAGAGTCGGG + Intronic
1167531548 19:50020807-50020829 GCTGCTGTTTCCCTAGTGGCTGG - Intronic
1167723965 19:51198767-51198789 GCTGCAGGACCCCCAGAGGCTGG - Intergenic
925285047 2:2710232-2710254 GCTCCTTTGCCCCCAGAAGCGGG + Intergenic
926684474 2:15688226-15688248 GCGGCTGTTCCCCCATCAGCTGG + Intergenic
927207437 2:20619114-20619136 CCAGCTGTTCCCCCCAAAGCGGG - Exonic
928584199 2:32741689-32741711 ACAGCTGTTGCCCCAGAACCTGG + Intronic
929438613 2:41948225-41948247 GCTGCTGTTCAGCAAGCAGCAGG + Intronic
929544405 2:42846277-42846299 GCTGCTGTTCCCACAGTGGGAGG - Intergenic
932432666 2:71685230-71685252 TCTCCTGTCCCCCCAGCAGCGGG + Intronic
932583671 2:73008887-73008909 GCTGGTTTTCTCCCAGAGGCTGG - Intronic
934277568 2:91587061-91587083 GCGGCTTTTCCTCCCGAAGCTGG - Intergenic
935077301 2:99757612-99757634 GCTGAAGTTCACCCAGCAGCTGG + Intronic
937297726 2:120819867-120819889 GCCTCTCTTCCCCCAGCAGCAGG - Intronic
940112903 2:150173765-150173787 GCTACTGTTGCCCCAGTAGCGGG - Intergenic
943157474 2:184201776-184201798 GCGGCTGTTCCCACAGCAGTGGG + Intergenic
946245817 2:218386836-218386858 CCTGCTGTCCCCTCTGAAGCAGG + Intronic
946397088 2:219448631-219448653 GCTGCGCTTCGCCCAGGAGCTGG + Exonic
946717913 2:222572550-222572572 GGTGTGGTTCCCCCAGTAGCCGG - Intronic
948843654 2:240672658-240672680 GCTGCTGATCGCCCAGCACCTGG + Intergenic
1168921438 20:1539738-1539760 GCTGCTTCTCCTCAAGAAGCAGG - Intronic
1170120629 20:12907670-12907692 GCTACTGTTTCCTCTGAAGCAGG - Intergenic
1170932755 20:20783575-20783597 TCTGCTGATCCCACAGACGCAGG - Intergenic
1171509726 20:25671936-25671958 GGTGCTGCTCTCCCAGGAGCTGG - Intergenic
1171981758 20:31633536-31633558 CCTGATGTTCCCACAGAGGCGGG + Intergenic
1172672871 20:36646275-36646297 GCAGCTGCTCCCCTAGAAACAGG - Intergenic
1172874899 20:38158265-38158287 TCTCCTGTTCCCCCAGGATCTGG - Intronic
1173856251 20:46252253-46252275 GGTGCTGTATCCCTAGAAGCTGG - Intronic
1174045172 20:47728130-47728152 TCTGCTGTCCCCCCACAGGCCGG + Intronic
1175433889 20:58928852-58928874 GCTGCTGTGACCCCTGAGGCTGG + Intergenic
1176198464 20:63848507-63848529 GCTGCTCAGCCCCCAGGAGCTGG - Intergenic
1177475648 21:21618285-21618307 GCTACTTTTGCCTCAGAAGCAGG - Intergenic
1178777889 21:35569506-35569528 CCTTCTTTTCCCCCAGAATCTGG - Intronic
1181163965 22:20973743-20973765 GCTGCGGTTCCCCAGGATGCGGG + Exonic
1181540413 22:23570009-23570031 GGTGCTGCATCCCCAGAAGCTGG + Intergenic
1181556997 22:23676930-23676952 GCTCCTGTGCCCCCAGAGCCTGG + Intergenic
1181630507 22:24148737-24148759 GCAGCTGTTCCAGCAGAGGCAGG + Intronic
1181666243 22:24399721-24399743 GCTGCTTCTCCCACAGAATCAGG + Intronic
1181861663 22:25823724-25823746 GCTGGTGTATCCCCAGGAGCTGG - Intronic
1182298876 22:29327159-29327181 GCTGCTCCTCCCTCAGAAGCAGG + Intergenic
1184356125 22:43980649-43980671 GCTTCTGTCCCCACAGCAGCTGG - Intronic
1184992557 22:48180630-48180652 GCTTCTTGTCACCCAGAAGCAGG + Intergenic
1185019693 22:48366946-48366968 GCTGCTGGGCCCACAGATGCTGG - Intergenic
1185091615 22:48778744-48778766 TCTGCTGTTCTTCCAGGAGCAGG + Intronic
950323700 3:12083680-12083702 GCTGCTGCTCCCACTGAAGATGG + Intronic
953359171 3:42280060-42280082 GCTGCTGTTCCAGCTCAAGCTGG + Intergenic
954317178 3:49807495-49807517 GCTGCAGCTCCCCCAGATCCTGG + Intronic
955735678 3:62035834-62035856 GGAGCTGTTCTCCCAGATGCTGG + Intronic
955938594 3:64127014-64127036 GCTGGTGTTGCCCCAGCAGCTGG - Intronic
959121743 3:102241155-102241177 GCTGCTGTTCACCATGAACCAGG - Intronic
961650908 3:128416246-128416268 GCTGTTGTGCCCCCAGGGGCAGG - Intergenic
963233660 3:142934866-142934888 CCTGATGTTGCCTCAGAAGCAGG - Intergenic
965838486 3:172877410-172877432 TGTGTTGTTCCCCCAGAAGCAGG - Intergenic
966552094 3:181216603-181216625 GCTGCTAATACCCCTGAAGCTGG + Intergenic
968509122 4:987622-987644 GCTGCCGTTCCCCATGAAGATGG + Intronic
968956912 4:3724160-3724182 GCAGCTGTGCCCCAAGAAGGGGG + Intergenic
969033175 4:4229287-4229309 GCGGCTTTTCCTCCCGAAGCTGG + Intergenic
969258836 4:6021271-6021293 GCTGTTGTTCCAGCAGAAACGGG - Intergenic
970683181 4:18535122-18535144 GCTCCAGTTCTCCAAGAAGCAGG - Intergenic
970882481 4:20948098-20948120 TCTGGTGTTGCCTCAGAAGCAGG - Intronic
973236250 4:47909300-47909322 GCTGCTTTTTCCCCATAAACAGG + Intronic
974505909 4:62771925-62771947 GCTGATCTTCCCCCAGAATCTGG - Intergenic
981745580 4:148049449-148049471 GTTGCTGTCCTCCCAGTAGCCGG + Intronic
983435838 4:167714010-167714032 GCTGTTGTCCCTCTAGAAGCAGG + Intergenic
984597931 4:181692891-181692913 GCTGCCTTTGCCACAGAAGCTGG + Intergenic
984896820 4:184548631-184548653 GCTGCTGTTCCCTTCGAAGGAGG - Intergenic
984958360 4:185068997-185069019 GCAGCTCTCCCCCCAGAGGCAGG + Intergenic
985630736 5:1012736-1012758 GCTGGCCTTCCCCCAGAGGCAGG + Intronic
985688269 5:1293615-1293637 GCTGCGGTCACCCCAGCAGCCGG - Exonic
985911556 5:2887752-2887774 TCTGCTCTCCCCCCAGCAGCAGG + Intergenic
986644379 5:9902340-9902362 GCTGCTGTCTCCCCAGATCCTGG + Intergenic
986652748 5:9980431-9980453 GCTGCCCTTCCCTCAGAAGAAGG - Intergenic
988358130 5:30202524-30202546 GCCACTGTTCTCCCAGAAGATGG + Intergenic
991298275 5:65103398-65103420 GCTGTTCCTCCCCCAGCAGCAGG + Intergenic
995004573 5:107176028-107176050 GCTCCAGTTCCCCCAGAAGATGG + Intergenic
995219431 5:109631222-109631244 GCTGCTGTTTCCTAAAAAGCTGG - Intergenic
997292631 5:132748278-132748300 ACTCCTGGTCCCCCAGCAGCAGG - Intronic
999631972 5:153580698-153580720 GCAGCTGACCCCCCAGAAACTGG - Intronic
1001130622 5:169060677-169060699 GCTGAAATTCCCCCAGGAGCAGG - Intronic
1001280863 5:170385414-170385436 GCTGGTGATGGCCCAGAAGCGGG - Exonic
1001454271 5:171848675-171848697 GCTGCTCCTCCCCCACATGCAGG - Intergenic
1002000222 5:176192993-176193015 GATGCTGTGCCCCCTGAGGCAGG - Intergenic
1002254118 5:177945991-177946013 GATGCTGTGCCCCCTGAGGCAGG + Intergenic
1002546957 5:179955156-179955178 GCTGCAGCACCCCCAGCAGCAGG - Exonic
1005896878 6:30186071-30186093 GCTGGTGTTGGCCCAGATGCCGG + Exonic
1006029133 6:31166264-31166286 ACTACTCTTCCCCCAGAAACTGG + Intronic
1011596654 6:89023148-89023170 GCTGCTGATCCTCCAAATGCAGG - Intergenic
1019078772 6:169412963-169412985 GCTTCTGCTCCCCCAGACCCAGG - Intergenic
1019515350 7:1437577-1437599 GCTGCTGCTCCTCCAGACGCTGG + Exonic
1019561951 7:1663901-1663923 GCTGCTGTCCCCCCTCAGGCTGG - Intergenic
1020009719 7:4801470-4801492 GCTGCTCAGCCCCCAGCAGCTGG - Intronic
1022384223 7:29886903-29886925 GCAGCTGTTCACCCAGAAGAGGG + Intronic
1029868148 7:103658599-103658621 GCTGCTGTTCCCTCAAGATCTGG + Intronic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1029996350 7:105012390-105012412 GACGTTGTACCCCCAGAAGCTGG + Intergenic
1031064927 7:117094552-117094574 GCTGCTGTGTCCCCAGAATCTGG + Intronic
1031844776 7:126792073-126792095 GCTGCTGTTATCCCAGTACCTGG + Intronic
1032096029 7:128938930-128938952 GGTGCTGCTCCTCCAGCAGCAGG + Intronic
1033508163 7:142026840-142026862 GCTGCTTTTTCCCCAGAACCTGG + Intronic
1033973474 7:147071359-147071381 GCTGCTGTTCCCACAGAGTATGG - Intronic
1034260111 7:149749972-149749994 GCTGCTGTTCCCACCAAAGACGG + Intergenic
1034272975 7:149812250-149812272 TCTGCTGTGTCCCCAGGAGCTGG + Intergenic
1035160117 7:156944036-156944058 GCGGCTGTTGACCCAGAAGATGG + Intergenic
1037290538 8:17345295-17345317 CCTGCCCGTCCCCCAGAAGCAGG + Intronic
1038145563 8:24892080-24892102 GCTGCTGGTTCCCCTGGAGCTGG + Intergenic
1038847010 8:31239302-31239324 CCTGCTTTTCCCCAAGAAGTGGG - Intergenic
1038988862 8:32844116-32844138 ACTGTTGTTCCCCCAGCATCAGG - Intergenic
1040787916 8:51188637-51188659 GCAGCAGTTCTCCCTGAAGCAGG + Intergenic
1042411930 8:68475933-68475955 TCCTCTGTTCCCCCAGCAGCTGG - Intronic
1042714823 8:71761259-71761281 ACTGCTGTACCCCCAGCACCAGG - Intergenic
1044185441 8:89245429-89245451 GCTTCAGTTCCCCTAGAAGTTGG + Intergenic
1049064023 8:140298882-140298904 GCTGCTGTCTCCCCAGCACCTGG - Intronic
1049160854 8:141096587-141096609 TTGGCTGCTCCCCCAGAAGCAGG - Intergenic
1049321569 8:141999607-141999629 GTTTGGGTTCCCCCAGAAGCGGG - Intergenic
1049360732 8:142211496-142211518 GCACCTGTTCCCCCAGGAGTAGG - Intergenic
1049838259 8:144754243-144754265 GCAGCTGGGCCCCCAGCAGCGGG - Exonic
1050473350 9:6015989-6016011 GCCTCAGTTCCCCCAGTAGCTGG + Intergenic
1053415878 9:37946526-37946548 GCTGCTGTTCCCTCGAAGGCAGG + Intronic
1055478587 9:76687869-76687891 GCAGCAGTTCCTCCAGATGCGGG + Intronic
1055549848 9:77422911-77422933 GCTGCAGTTCCCTCAGTAGCTGG - Intergenic
1058227356 9:102381888-102381910 GCTGGAGTTACCCCAAAAGCAGG + Intergenic
1061480732 9:130896586-130896608 ACTTCTGATCCCCCAGCAGCCGG - Intergenic
1061989094 9:134148410-134148432 ACTGCTGTACCCCCAGATGCAGG - Intronic
1062575436 9:137205099-137205121 GATGCTGTTGTGCCAGAAGCTGG - Exonic
1186409625 X:9335369-9335391 TCTGCTTTTCCCCCATGAGCCGG + Intergenic
1190277680 X:48909814-48909836 GCTGCTCTTCGCACAGAAGAGGG - Exonic
1190917953 X:54824210-54824232 GCTGCTGTTTCCACAGCAGTGGG + Intergenic
1192394244 X:70762493-70762515 GCTGCTGATCTGCCAGAAGGTGG - Intronic
1193952220 X:87813774-87813796 GCTGCTGTGTCCACAGAAGCTGG + Intergenic
1195739581 X:108050068-108050090 GCTGCTTTCCTGCCAGAAGCTGG - Intronic
1196950907 X:120875145-120875167 GCTGCTGCTGTCCCAGAGGCTGG - Exonic
1196951745 X:120931520-120931542 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196952429 X:120936381-120936403 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196953114 X:120941242-120941264 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196953799 X:120946102-120946124 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196954484 X:120950963-120950985 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196955167 X:120955823-120955845 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196955854 X:120960706-120960728 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196956536 X:120965567-120965589 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196957218 X:120970427-120970449 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196957900 X:120975287-120975309 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196958582 X:120980147-120980169 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196959263 X:120985007-120985029 GCTGCTGCTGCCCCAGAGGCTGG - Exonic