ID: 1084891367

View in Genome Browser
Species Human (GRCh38)
Location 11:72238645-72238667
Sequence GACCCCCACAGGCACCCCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 282}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084891367_1084891374 -5 Left 1084891367 11:72238645-72238667 CCCCAGGGGTGCCTGTGGGGGTC 0: 1
1: 0
2: 3
3: 24
4: 282
Right 1084891374 11:72238663-72238685 GGGTCCATTTGGGTACGTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 47
1084891367_1084891379 20 Left 1084891367 11:72238645-72238667 CCCCAGGGGTGCCTGTGGGGGTC 0: 1
1: 0
2: 3
3: 24
4: 282
Right 1084891379 11:72238688-72238710 CCCACTTTCACCAGTTTCTGCGG 0: 1
1: 0
2: 1
3: 15
4: 184
1084891367_1084891373 -6 Left 1084891367 11:72238645-72238667 CCCCAGGGGTGCCTGTGGGGGTC 0: 1
1: 0
2: 3
3: 24
4: 282
Right 1084891373 11:72238662-72238684 GGGGTCCATTTGGGTACGTCTGG 0: 1
1: 0
2: 1
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084891367 Original CRISPR GACCCCCACAGGCACCCCTG GGG (reversed) Exonic
900265440 1:1754760-1754782 GACTCCCACTGGCCTCCCTGGGG - Intronic
900393645 1:2444328-2444350 GACCCACACAGGGTGCCCTGCGG - Intronic
900448122 1:2691824-2691846 GACCATCACATGCACACCTGGGG - Intronic
900450976 1:2749604-2749626 GACCATCACATGCACACCTGGGG - Intronic
900575470 1:3380296-3380318 GACCTCCTCAGTCACCCCAGGGG + Intronic
900608826 1:3535877-3535899 GGCACCCACAGGCGCCCCTCTGG + Intronic
900987561 1:6082061-6082083 GGGCCCGACAGGCTCCCCTGTGG - Intronic
901053914 1:6440050-6440072 GACGCCCTCAGGGACCTCTGAGG + Intronic
901066933 1:6498650-6498672 GGCTGCCACAGGCACCCCGGGGG + Intronic
901206322 1:7497977-7497999 GACTCCCACAGGGAGCACTGAGG - Intronic
901402288 1:9022954-9022976 GACCCCAACAGGCCGCCCAGAGG + Exonic
901445149 1:9303973-9303995 CACCCTCACAGACACACCTGGGG - Intronic
902188155 1:14740922-14740944 CACCCCCACAGGCACCATGGAGG - Intronic
902501684 1:16915105-16915127 GACCCCCACAGGGGCCACTTGGG - Intronic
902517091 1:16995382-16995404 GACCAACACAGGCATCCTTGTGG - Intronic
902618422 1:17636564-17636586 GATCCCCACAGGGCACCCTGTGG - Intronic
902977540 1:20099838-20099860 AACCCCCAAAGGCTCCCCTGGGG + Intergenic
903534998 1:24060942-24060964 GAGCCCCACAGACCCCACTGTGG + Intronic
904363910 1:29998600-29998622 CACCCTCAGAGGCACACCTGGGG + Intergenic
905037701 1:34928825-34928847 GACACACACAGGCACACATGGGG + Intronic
907474287 1:54695313-54695335 CCCCCCCACAGGTCCCCCTGGGG + Intronic
912405492 1:109434245-109434267 GAGCCCCACAGGGTCCCCAGCGG - Intergenic
912757567 1:112337129-112337151 GAACCTCACAGGCCCCCTTGTGG + Intergenic
917226307 1:172787872-172787894 GACTGACACAGGCACCTCTGTGG + Intergenic
919403279 1:197146528-197146550 GACCTCTACAGCCGCCCCTGAGG - Exonic
920322905 1:205138302-205138324 GACCTCCACAGCCACCCTTCTGG - Intergenic
922874422 1:228928758-228928780 GAACCCCAGAGGCAGGCCTGAGG - Intergenic
1062853100 10:760215-760237 GTCCCCCACTGCCACCACTGGGG + Intergenic
1063142201 10:3265229-3265251 CACCCCCACTGCCACCCCTCAGG - Intergenic
1063152215 10:3347205-3347227 GACTCACACTGGCATCCCTGTGG - Intergenic
1063966810 10:11352431-11352453 GCCCCCCAGAGCCACACCTGTGG + Intergenic
1066703678 10:38156477-38156499 GATACCCACAGGCAGCCCGGAGG + Intergenic
1066987050 10:42476475-42476497 GATACCCACAGGCAGCCCGGGGG - Intergenic
1070590146 10:77795402-77795424 GACCCCCAGATGCTCCACTGGGG + Intronic
1071343655 10:84670905-84670927 CACCCTCATAGGCACCCCTGGGG + Intergenic
1072608705 10:97002976-97002998 GACATCCACGGGCATCCCTGGGG + Exonic
1074401043 10:113141380-113141402 GGCCTCCACAGGAACCCCAGGGG + Intronic
1074894745 10:117765465-117765487 GAGCCCCCAAGGCACCTCTGAGG + Intergenic
1075165240 10:120062251-120062273 GCCTCCCACAGGCAGCCATGTGG - Intergenic
1076370452 10:129949567-129949589 GATCCCCACATGCACGCCTGGGG + Intronic
1077102736 11:829354-829376 CACCCCCACAAACATCCCTGCGG - Exonic
1077219360 11:1408564-1408586 GACCCTCAAGGACACCCCTGTGG + Intronic
1077219724 11:1410640-1410662 CACCCACCCAGGCACACCTGTGG + Intronic
1077462357 11:2716960-2716982 CAGCTCCACAGGCACCACTGAGG - Intronic
1079336596 11:19575602-19575624 TACCTCCTCAGACACCCCTGGGG + Intronic
1080798106 11:35584371-35584393 GGCTCCCACAGGCCCCCCTAAGG + Intergenic
1081745818 11:45471549-45471571 GTCCTCCCCAGGCATCCCTGGGG - Intergenic
1081907660 11:46679760-46679782 GAAATCCACAGGCAGCCCTGGGG + Exonic
1082794922 11:57371789-57371811 GACTCCCCCAGGCATCCCTGGGG + Intergenic
1082797462 11:57388437-57388459 GACACCCACAGACAACACTGAGG - Intronic
1083322810 11:61857618-61857640 GGGCCCCACAGGCTCCACTGGGG - Intronic
1084446683 11:69207692-69207714 GACTCCCACAGGTGCCCCGGAGG + Intergenic
1084883741 11:72190014-72190036 GACCCCCACACCCAACCTTGGGG - Intronic
1084891367 11:72238645-72238667 GACCCCCACAGGCACCCCTGGGG - Exonic
1084941267 11:72614701-72614723 GACCCAAACAGGCACCTCTTGGG - Intronic
1086060582 11:82695865-82695887 GGAGCCCACAGGCACCTCTGGGG - Intergenic
1089343452 11:117775272-117775294 ACCCCACACAGCCACCCCTGCGG + Intronic
1090395168 11:126414099-126414121 CACCCCCACAGCCACGCATGGGG - Exonic
1090820456 11:130337346-130337368 CAGCTCCACAGGCGCCCCTGTGG - Intergenic
1091369697 11:135047729-135047751 CAGCCCCACAGGCACCCCCAGGG - Intergenic
1092183413 12:6461635-6461657 GGCCCTCAGAGGCACCCCCGTGG + Intronic
1094240816 12:28222283-28222305 CACCACCACCGCCACCCCTGTGG - Intronic
1097074561 12:56383410-56383432 GACCCGCATAAGCTCCCCTGGGG + Intergenic
1097165939 12:57087029-57087051 GACCCCCGCTGGCTCCCCTAGGG + Intronic
1097323585 12:58251571-58251593 GAACTCCACAGGCACGGCTGAGG - Intergenic
1101098524 12:101368693-101368715 GATCCTCACAACCACCCCTGAGG + Intronic
1102002020 12:109563349-109563371 CACCCTCACAGACACCCGTGAGG - Intronic
1102246699 12:111361012-111361034 GCTCTCCACAGGCACCTCTGGGG - Exonic
1102426768 12:112849925-112849947 GACCCCCAGAGGCAGCCCAGTGG - Intronic
1104321507 12:127755855-127755877 GACATCCAGAGGCACCCATGTGG + Intergenic
1104904559 12:132206229-132206251 CACCCCCACGTGCACCCCTCAGG + Intronic
1104970852 12:132529978-132530000 GACACCCACAGCCACCTCTGAGG - Intronic
1104974620 12:132546742-132546764 GACCCCAGCTGGGACCCCTGGGG - Intronic
1106603725 13:31208908-31208930 GACCCGGGCAGGAACCCCTGTGG - Intronic
1106758580 13:32846090-32846112 GTCCCCCACCTGCACCCCAGTGG - Intergenic
1106837068 13:33645796-33645818 GACCCCCACAGGCATTCCTGTGG - Intergenic
1107538621 13:41362764-41362786 GAGCCGCAAATGCACCCCTGAGG + Intronic
1110306518 13:73993955-73993977 CACCCACACAGGCAACACTGAGG + Intronic
1114239002 14:20848859-20848881 GGCTCCCACAGTCACCCATGTGG - Intergenic
1117951837 14:61090644-61090666 AAGCCCCACAGCCACCTCTGTGG + Intergenic
1118974273 14:70663877-70663899 CATCCCCACAGACACCCCAGAGG + Intronic
1119732694 14:76961142-76961164 TTCCCCTACAGGCACTCCTGGGG - Intergenic
1122327632 14:100891906-100891928 GACCCCCGCAGGCACCTCTTAGG - Intergenic
1122370346 14:101225957-101225979 GACCCCCACTGGCCCTCCTGGGG + Intergenic
1122441877 14:101737506-101737528 GACCCCCAGTGGGACCCCAGTGG - Intergenic
1122743142 14:103883218-103883240 CACCCTCACAGCCACCCTTGAGG - Intergenic
1123450636 15:20357337-20357359 GACCCACCCAGGCATACCTGGGG + Intergenic
1124231213 15:27947721-27947743 CAACCCCACAGACAGCCCTGAGG + Intronic
1126844979 15:52751131-52751153 CCCCACCACAGTCACCCCTGTGG + Intergenic
1127611734 15:60643773-60643795 AACCCACAGAGGCAGCCCTGAGG + Intronic
1128261901 15:66238445-66238467 GATCCCCACACGCACTCTTGGGG + Intronic
1128580933 15:68809112-68809134 GTCCCCTCCAGTCACCCCTGGGG - Intronic
1128673356 15:69591080-69591102 CACCCCTGCAGCCACCCCTGTGG - Intergenic
1129129858 15:73483956-73483978 GACCCCCACCAACTCCCCTGGGG + Intronic
1129246110 15:74279979-74280001 GACCCCCAGAGCAGCCCCTGTGG + Exonic
1129886655 15:79042723-79042745 GATCCTCAGAGGCACCCATGAGG - Intronic
1131271442 15:90949896-90949918 GACCTTCACAGGCACCAGTGTGG - Intronic
1132354833 15:101163479-101163501 GACCCTCAGGGGCACCTCTGAGG - Intergenic
1134009641 16:10842464-10842486 GACCCCCACAGGGGCTTCTGGGG - Intergenic
1134671670 16:16060288-16060310 GACACCCACAGTCACTCATGGGG + Intronic
1138093560 16:54195039-54195061 GACCCCAGCAGGCCTCCCTGTGG - Intergenic
1139355378 16:66364419-66364441 GACCCCCAGCCCCACCCCTGGGG + Intergenic
1139591170 16:67934112-67934134 GGCCCCCACAGGCCCCACTGAGG - Intronic
1139697375 16:68684761-68684783 GACACACACAGGCTCCCCAGTGG - Exonic
1140567005 16:76055533-76055555 GAGCAACACAAGCACCCCTGTGG + Intergenic
1140646524 16:77037752-77037774 GAGTCACACTGGCACCCCTGTGG + Intergenic
1141097605 16:81174024-81174046 CACCCACACACACACCCCTGTGG - Intergenic
1141126881 16:81407245-81407267 GTCACCCACAGGCACACCTGTGG - Intergenic
1142145490 16:88491263-88491285 GGCGCCCACAGGCCCCCCTCGGG + Intronic
1142250472 16:88989586-88989608 GACCCCCGCAGACACCCCTGGGG - Intergenic
1142286989 16:89175527-89175549 GACCACCACAGGCTCCCGGGGGG + Intronic
1142518586 17:489782-489804 GACCCCCACGGGAGCCCCGGCGG - Intergenic
1142608655 17:1096187-1096209 GACCCCCACAAGCACCCCAGAGG + Intronic
1143449481 17:7027342-7027364 TATCCCCTCAGCCACCCCTGAGG + Intronic
1144785779 17:17830815-17830837 GACACACACAGCCGCCCCTGTGG + Intronic
1146578847 17:34018665-34018687 AACCCTCACAGTCACCCATGAGG - Intronic
1147371180 17:39994164-39994186 ACCCTCCACAGGCACCCATGAGG - Intronic
1148347362 17:46912361-46912383 GACCCCTACCAGCAGCCCTGAGG - Intergenic
1148906343 17:50914910-50914932 GCCCCTCACAGCCATCCCTGAGG - Intergenic
1150289706 17:63974135-63974157 GACCCCCAAAGCCACACCTGAGG + Intergenic
1151298580 17:73204390-73204412 ACTCCCCACAGTCACCCCTGAGG - Intronic
1151632083 17:75317947-75317969 GAGCCCCACATGCTCCCCTAGGG + Intergenic
1151688262 17:75662655-75662677 GACCGCCACAGCCACCCCACAGG - Exonic
1152252442 17:79219054-79219076 GGGCCCCACAGGCACCTGTGCGG + Intronic
1152555432 17:81050559-81050581 GACCCCCACAGGCCCCCGGGTGG - Intronic
1152586415 17:81191398-81191420 GAGCCCCCCAGGACCCCCTGAGG - Intronic
1152652077 17:81499463-81499485 GGCCTCCCCAGGCAGCCCTGCGG + Intergenic
1157490972 18:48123505-48123527 CAACCCCACAGGGACCTCTGGGG - Intronic
1158351141 18:56566015-56566037 GTCCCCCAGAGTCCCCCCTGAGG + Intergenic
1160509370 18:79444650-79444672 CGCACACACAGGCACCCCTGTGG + Intronic
1160616779 18:80136676-80136698 GAGCCCCTCTGTCACCCCTGGGG + Exonic
1160685848 19:436350-436372 GACCCCCACCGGCCTCCCCGGGG + Intronic
1160740103 19:681639-681661 GACCCTTGCAGGCACCCCTGAGG + Exonic
1160772587 19:839702-839724 GCCTCACACAGGGACCCCTGGGG + Intergenic
1160839697 19:1140594-1140616 CACCCCCACCCCCACCCCTGGGG - Intronic
1161172471 19:2819924-2819946 GCCCCCCGCAGGCGCCCCTCAGG - Exonic
1161984187 19:7644868-7644890 AACCCCCACAGCTACCCCTCTGG + Intronic
1162535737 19:11262205-11262227 GACCCCCGCCGGGACCCCCGCGG + Intronic
1163435364 19:17292277-17292299 GAGCCCCACAGGGACCCTCGAGG - Exonic
1163458462 19:17422523-17422545 GACCCTCAAGGACACCCCTGAGG + Intronic
1163506164 19:17707630-17707652 GCCCCCCATAGCCAGCCCTGAGG + Intergenic
1164428335 19:28164922-28164944 GAGCCCCACAGGCTCCTCAGGGG - Intergenic
1164558503 19:29271457-29271479 TGCCACCACAGGCATCCCTGTGG + Intergenic
1165040602 19:33065106-33065128 GACGCCCACAGACAACCCCGAGG - Intergenic
1165330762 19:35140177-35140199 GGTCCCCACCGCCACCCCTGGGG - Intronic
1165559713 19:36668324-36668346 CACCCCCACAGGGGCCACTGCGG - Intergenic
1166015955 19:39979648-39979670 GAGCCCCACATCCAGCCCTGAGG - Intronic
1166283198 19:41808822-41808844 GGCCCCCACAGGAAGGCCTGGGG - Exonic
1166411126 19:42555892-42555914 GGCCCCCACAGGAAGGCCTGGGG + Intronic
1166749547 19:45158475-45158497 GACCCCAACAGGCAAAGCTGAGG + Intronic
1167479454 19:49720742-49720764 GAACCCCAAAGGCACAACTGAGG - Intergenic
925196520 2:1930338-1930360 GGCCCCCACAGGGACCACAGGGG - Intronic
927464841 2:23329230-23329252 GCCCCCCACAAGCAACCCTCTGG + Intergenic
928123775 2:28602423-28602445 GACCACCAGATGCTCCCCTGTGG + Intronic
931621946 2:64219356-64219378 GACTCCCACACTGACCCCTGAGG + Intergenic
934066052 2:88343020-88343042 GCCTCCCACTGGCACCCCTCTGG + Intergenic
934133212 2:88969630-88969652 GACCCTGCCAGGCAGCCCTGCGG - Intergenic
934762697 2:96865176-96865198 GGCTCCCACAGGCCCCCCGGTGG + Intronic
935128960 2:100247244-100247266 GGACCCCACAGCCACCACTGAGG - Intergenic
937000695 2:118464565-118464587 GATCCCCGCAGGCTCTCCTGGGG + Intergenic
937194116 2:120134546-120134568 GAACGACACAAGCACCCCTGTGG - Intronic
937560666 2:123219709-123219731 GACTGACACAAGCACCCCTGTGG - Intergenic
938411574 2:131069055-131069077 GGCCCCCACAGGCACCCAAGGGG + Intronic
938749497 2:134315083-134315105 GACCCACACTGTCAGCCCTGGGG + Intronic
938899965 2:135791453-135791475 TCCCCCAGCAGGCACCCCTGTGG - Intronic
939473234 2:142652005-142652027 CACCCTCACAGGCACATCTGGGG + Intergenic
945427062 2:209719254-209719276 GACCCCCTCAGGCATCCATTAGG - Intronic
946401976 2:219472986-219473008 GACCCCCTTACGCAGCCCTGTGG - Exonic
946427192 2:219605675-219605697 GACCCCCAGAGCAGCCCCTGAGG - Exonic
947376660 2:229503197-229503219 GACCCCCACTGGCAAAACTGGGG + Intronic
947794086 2:232883499-232883521 GACCCCCACAGGCCTCCTCGGGG - Intronic
1170537612 20:17356873-17356895 CACCCACAGAGGCACCCCTAAGG + Intronic
1170877629 20:20265653-20265675 GACTCCCCCAGGCACCTCTCAGG + Intronic
1171459107 20:25288611-25288633 CACCCCCACAGGCATACCAGAGG - Intronic
1173048998 20:39540958-39540980 GACACCCAAAGGCACCCCTTGGG + Intergenic
1174048895 20:47753770-47753792 GAGCCCCAGAGGCTCCCCAGAGG + Intronic
1174421299 20:50400722-50400744 CACCTCCACAGCCACCCCTTGGG - Intergenic
1176209250 20:63909803-63909825 GCCCCCCGCAGGCTCTCCTGAGG - Intronic
1176924397 21:14729964-14729986 GACCCTCTCTGTCACCCCTGTGG - Intergenic
1178389320 21:32185408-32185430 GAGCACCACAGGCCTCCCTGTGG - Intergenic
1178760770 21:35400791-35400813 GACTCCCACTGTCACCTCTGTGG + Intronic
1179279819 21:39924933-39924955 GGTCCCCACAGGCTCCTCTGGGG + Intronic
1179793420 21:43768572-43768594 CACCCCCACAGTCAGCCTTGCGG + Intergenic
1179904623 21:44416009-44416031 AACCCCCAGAGCCAACCCTGGGG - Intronic
1180745801 22:18088144-18088166 CACATCCACAGGCGCCCCTGGGG + Exonic
1180867163 22:19126250-19126272 AACCCCCACTGGCAGCCTTGTGG - Intergenic
1180934994 22:19619604-19619626 GACACCCCCAGAGACCCCTGAGG - Intergenic
1181004023 22:20001184-20001206 GACCCCCTCTGAGACCCCTGAGG + Intronic
1181396794 22:22628733-22628755 GCTCACCACAGGCACACCTGGGG - Intergenic
1181499487 22:23307781-23307803 GCTCACCACAGGCACACCTGGGG - Intronic
1181704917 22:24644291-24644313 GCTCACCACAGGCACACCTGGGG - Intergenic
1182096719 22:27630680-27630702 TACACCCACAGGCAGCTCTGGGG - Intergenic
1182362604 22:29755806-29755828 GACCCCCACATCCCCTCCTGTGG + Intronic
1182471993 22:30554556-30554578 GACTCACCCAGGCACCACTGTGG + Intergenic
1183349762 22:37328473-37328495 GGCCCCCACAGGCACAAATGTGG - Intergenic
1183939572 22:41285830-41285852 CACTCCCACCGCCACCCCTGGGG + Intronic
1185345305 22:50308107-50308129 CACCCCCACAGGAACCCCGCAGG + Intergenic
949906672 3:8863897-8863919 TACCCCCAAACCCACCCCTGGGG + Intronic
950345617 3:12288794-12288816 GACCCCCAGCCGCACCCCGGGGG + Intronic
950531136 3:13552926-13552948 AACCCATGCAGGCACCCCTGGGG - Intronic
951056623 3:18153968-18153990 CACCCCTACAGACACACCTGGGG + Intronic
953883424 3:46702886-46702908 GCCCCTCACAGGCTGCCCTGAGG + Intronic
954406137 3:50345964-50345986 GACCCCAACAGCCCCTCCTGCGG + Exonic
954711006 3:52505113-52505135 GGCCCCCTCTGGGACCCCTGGGG + Exonic
954874918 3:53795868-53795890 GACCCCCACAAGCTCCCCTAGGG - Intronic
955360405 3:58269213-58269235 GACCCAGACAGCCATCCCTGGGG - Intronic
957643741 3:82891193-82891215 CACCCTCACAGACATCCCTGGGG + Intergenic
961055954 3:123789152-123789174 GAAGCCCCCAGCCACCCCTGAGG + Intronic
963965269 3:151361874-151361896 TACCCCCACAGGCAGCACTAGGG + Intronic
965741886 3:171884172-171884194 GAGCCTCACACCCACCCCTGTGG + Intronic
966787975 3:183637092-183637114 GGGCCCCACGGTCACCCCTGAGG + Intronic
968035538 3:195544570-195544592 GAACCCTACAGTCATCCCTGAGG - Intergenic
968082112 3:195853836-195853858 GACCTCCACAGGCAGCCCCGAGG + Intergenic
968291475 3:197542850-197542872 GAACCTCACAGCCACCCCTTTGG - Intronic
968426685 4:528415-528437 GAGCCCCACGGCCACCCCTCAGG - Intronic
969053988 4:4390396-4390418 GACCCCCAAAGCCAGCCTTGGGG - Intronic
969076124 4:4579165-4579187 GACCCCTACAGGCACCCTGGTGG + Intergenic
969309938 4:6347323-6347345 GACCTCCACGGATACCCCTGTGG + Intronic
975175627 4:71285380-71285402 TACCCCCACTGGCTCACCTGGGG + Intronic
978303406 4:107295052-107295074 GACCAAGACAGGCATCCCTGTGG + Intergenic
978934499 4:114358889-114358911 GACAGACACAAGCACCCCTGTGG + Intergenic
980960553 4:139470514-139470536 GGACCCCAAAGGCCCCCCTGTGG + Intronic
982202630 4:152974959-152974981 GAGCTCCACCGGCAGCCCTGAGG + Exonic
982866150 4:160514381-160514403 AAGCCACACAGGCACACCTGTGG + Intergenic
983235832 4:165178479-165178501 CACCCTCCCAGTCACCCCTGGGG - Intronic
985660255 5:1153430-1153452 GACCCCCCCAGAGGCCCCTGAGG - Intergenic
985733922 5:1566326-1566348 GCCCCCGACAGCCTCCCCTGAGG - Intergenic
986764456 5:10912075-10912097 GCCCCCAAAAGGCCCCCCTGGGG + Intergenic
988376338 5:30440029-30440051 GGACAACACAGGCACCCCTGTGG - Intergenic
988954921 5:36305905-36305927 GACCTCCAGAGGGAGCCCTGAGG - Intergenic
990148240 5:52787638-52787660 CACCCCGACAGGCTCCACTGAGG - Intergenic
991294107 5:65062639-65062661 GACTCCCACAGCCAACTCTGTGG - Intergenic
991639535 5:68739095-68739117 GAACCCCACAGGGAGCTCTGGGG + Intergenic
1000320270 5:160129173-160129195 TGACCCCACAGGCACCACTGTGG + Intergenic
1000399582 5:160811945-160811967 GAGTAACACAGGCACCCCTGTGG - Intronic
1001526198 5:172430456-172430478 CTTCCCCACAGGCACCCATGGGG - Intronic
1002093370 5:176817431-176817453 GACCCCCACAGCCTCTCCAGTGG - Intronic
1002188779 5:177468307-177468329 GGCCTCCACAGGCACCCCCAGGG + Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1003017675 6:2481092-2481114 GACCCCCACAAGTGACCCTGAGG - Intergenic
1003308525 6:4949209-4949231 GACGCCCACAGGCTCCCACGTGG + Intronic
1006437040 6:34031113-34031135 GACCCCAGCAGGCACTCCCGAGG + Intronic
1007125022 6:39418751-39418773 GAGCCCCACAGTCCCCTCTGTGG - Intronic
1009266411 6:61561262-61561284 GAATGCCACAAGCACCCCTGTGG + Intergenic
1013138326 6:107304855-107304877 TACGACCACAGGCACTCCTGTGG + Intronic
1014750637 6:125252044-125252066 AAGCCCCACACGCAGCCCTGTGG - Intronic
1015273388 6:131359684-131359706 CACCCTCACAGACACACCTGGGG + Intergenic
1015484732 6:133755932-133755954 GACTCCCACAGGAAATCCTGAGG + Intergenic
1016284512 6:142457952-142457974 GAACCTCACAGGCACACCTTTGG - Intergenic
1017086746 6:150719722-150719744 GGCCTCCACAGCAACCCCTGTGG - Intronic
1018899460 6:168043931-168043953 GGCTCCCTCAGGCCCCCCTGGGG - Intronic
1019297900 7:288828-288850 GACAGCTCCAGGCACCCCTGGGG + Intergenic
1020794015 7:12660597-12660619 GACCAAAACAGGCACCCCTGCGG - Intergenic
1020794023 7:12660650-12660672 GACCAAAACAGGCATCCCTGCGG - Intergenic
1020831115 7:13096677-13096699 GATCCTCACAGGCACACTTGGGG - Intergenic
1024522157 7:50314978-50315000 GACCCTGAAAGGCATCCCTGGGG - Intronic
1025249532 7:57342749-57342771 CACCTCCACAGCCACCCCTTGGG + Intergenic
1026051263 7:66948656-66948678 GACCCTCACGGCCAGCCCTGGGG + Exonic
1027344333 7:77241622-77241644 GACCCCCACAGGAGCCACCGAGG + Intronic
1029018942 7:97343917-97343939 GACTCCCTGAGGCACACCTGTGG + Intergenic
1029040301 7:97566087-97566109 CATCCTCACAGGCACACCTGGGG + Intergenic
1029248362 7:99218752-99218774 GGCCCCCAGAGGCACCTCCGTGG + Intergenic
1030232302 7:107221272-107221294 GAACCCCACCCCCACCCCTGGGG - Intronic
1031604954 7:123757663-123757685 GACCCCCAGAAACACCCCTGAGG + Intergenic
1032468082 7:132159313-132159335 GACCCCCGCAGGAGCCCATGGGG - Intronic
1034441489 7:151087907-151087929 GGCACCCGCAGGCACCCCGGTGG + Intronic
1034644488 7:152633198-152633220 GACCCAGTCATGCACCCCTGTGG - Intergenic
1034976030 7:155449699-155449721 GACCCCCACCGCCACCCCGTCGG - Intergenic
1034996153 7:155578364-155578386 GACCCCCACCAGCAGCCCTCAGG + Intergenic
1035259435 7:157652337-157652359 TACCCTCACAGGAACCCCAGGGG + Intronic
1035916547 8:3630835-3630857 GATCCCCACAGGCAACCAAGAGG + Intronic
1036756674 8:11475851-11475873 CACTCCCACACTCACCCCTGTGG + Intergenic
1039870422 8:41540800-41540822 GGACCACACAGCCACCCCTGCGG + Intronic
1040318556 8:46277544-46277566 GGGCCCCACTGCCACCCCTGGGG + Intergenic
1040329538 8:46378803-46378825 GTCCCCCAGAGTCCCCCCTGCGG - Intergenic
1040695746 8:49995736-49995758 GACCCACACAGACACCGCAGAGG - Intronic
1041733599 8:61087352-61087374 GACCCCCAAAGGGATCCTTGAGG + Intronic
1042328605 8:67554924-67554946 CACCCCCACAGTCACACCTGGGG + Intronic
1045189328 8:99867330-99867352 GAGCCCCTCAGGCAGTCCTGTGG - Intronic
1046454432 8:114440288-114440310 CACCCCCACATGTACTCCTGTGG + Intergenic
1047008105 8:120642467-120642489 GACCACCACAGGCCTCTCTGAGG + Intronic
1047694685 8:127391698-127391720 GAGCCCCAAAGGCCCCCCAGAGG - Intergenic
1048170588 8:132102534-132102556 CACCCCCTCAGGCACCCGTGTGG + Intronic
1048798141 8:138170753-138170775 CACCCTCACAGACACCCCTGAGG - Intronic
1049439029 8:142600877-142600899 GACCCTGACAGGCTCCCCAGCGG - Intergenic
1049555110 8:143277724-143277746 GCCCGCCACAGGCACATCTGGGG - Intergenic
1049555288 8:143278577-143278599 GCCCACCACGGGCACACCTGGGG + Intergenic
1049581218 8:143411933-143411955 GACCCCAAGAGGCACCCCATCGG - Intergenic
1049674567 8:143883911-143883933 GCCCCCCACAGCCTCACCTGGGG + Intergenic
1049674614 8:143884048-143884070 GCCCCCCACAGCCTCACCTGGGG + Intergenic
1049674636 8:143884108-143884130 GCCCCCCACAGCCTCACCTGGGG + Intergenic
1049674664 8:143884184-143884206 GCCCCCCACAGCCTCACCTGGGG + Intergenic
1049674686 8:143884244-143884266 GCCCCCCACAGCCTCACCTGGGG + Intergenic
1051810989 9:21049267-21049289 AACCCTCACAGACACACCTGGGG + Intergenic
1055641817 9:78324592-78324614 GACCCCGTCAAGCACCACTGTGG - Intronic
1055665155 9:78545703-78545725 GTACCTCACAGGGACCCCTGTGG + Intergenic
1056781718 9:89555713-89555735 GACTACCACAGGCCCCTCTGGGG + Intergenic
1057123701 9:92599918-92599940 GAGCTCCACAGGCTTCCCTGGGG + Intronic
1057311337 9:93945095-93945117 GACTCCTACAGATACCCCTGGGG + Intergenic
1059389176 9:113988159-113988181 AACCCCCACGGCTACCCCTGAGG - Intronic
1061293592 9:129665833-129665855 GACCCCCGCCGGCCCCCCCGGGG + Exonic
1062107503 9:134763971-134763993 GACCCCCACAACAACCCTTGAGG - Intronic
1062270870 9:135707738-135707760 GGCCCCCACAGCCTCGCCTGGGG + Intronic
1062626526 9:137445527-137445549 CACACTCACAGGCACGCCTGAGG + Intergenic
1185726729 X:2427549-2427571 GACTCCCACCAGCACCCCTGTGG - Intronic
1191198706 X:57753060-57753082 GACAGACACAGGCACCCTTGTGG - Intergenic
1193246065 X:79231813-79231835 GAGTGACACAGGCACCCCTGTGG + Intergenic
1195280405 X:103327620-103327642 TACCCTCACAGACACACCTGAGG + Intergenic
1195940832 X:110166574-110166596 GATCCCCACAGGCCTCCCAGGGG - Intronic
1197987033 X:132278027-132278049 GAGTCACACAAGCACCCCTGTGG + Intergenic