ID: 1084897501

View in Genome Browser
Species Human (GRCh38)
Location 11:72284445-72284467
Sequence ATTAGATACTAGGAGTAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084897501_1084897503 -7 Left 1084897501 11:72284445-72284467 CCTTATTACTCCTAGTATCTAAT No data
Right 1084897503 11:72284461-72284483 ATCTAATATCTAAGTCAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084897501 Original CRISPR ATTAGATACTAGGAGTAATA AGG (reversed) Intergenic
No off target data available for this crispr