ID: 1084900642

View in Genome Browser
Species Human (GRCh38)
Location 11:72307612-72307634
Sequence GTGGGTATTGAGAGGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 217}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084900642_1084900655 23 Left 1084900642 11:72307612-72307634 CCTGCATCCCTCTCAATACCCAC 0: 1
1: 0
2: 0
3: 14
4: 217
Right 1084900655 11:72307658-72307680 TGGAACCACATGGCAGATAGAGG 0: 1
1: 0
2: 0
3: 17
4: 182
1084900642_1084900659 28 Left 1084900642 11:72307612-72307634 CCTGCATCCCTCTCAATACCCAC 0: 1
1: 0
2: 0
3: 14
4: 217
Right 1084900659 11:72307663-72307685 CCACATGGCAGATAGAGGGTGGG 0: 1
1: 0
2: 1
3: 22
4: 194
1084900642_1084900656 24 Left 1084900642 11:72307612-72307634 CCTGCATCCCTCTCAATACCCAC 0: 1
1: 0
2: 0
3: 14
4: 217
Right 1084900656 11:72307659-72307681 GGAACCACATGGCAGATAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 211
1084900642_1084900651 13 Left 1084900642 11:72307612-72307634 CCTGCATCCCTCTCAATACCCAC 0: 1
1: 0
2: 0
3: 14
4: 217
Right 1084900651 11:72307648-72307670 AGCCAGGCCCTGGAACCACATGG 0: 1
1: 0
2: 4
3: 32
4: 309
1084900642_1084900647 -3 Left 1084900642 11:72307612-72307634 CCTGCATCCCTCTCAATACCCAC 0: 1
1: 0
2: 0
3: 14
4: 217
Right 1084900647 11:72307632-72307654 CACAGTCCTGCCATTTAGCCAGG 0: 1
1: 0
2: 1
3: 13
4: 182
1084900642_1084900657 27 Left 1084900642 11:72307612-72307634 CCTGCATCCCTCTCAATACCCAC 0: 1
1: 0
2: 0
3: 14
4: 217
Right 1084900657 11:72307662-72307684 ACCACATGGCAGATAGAGGGTGG 0: 1
1: 0
2: 3
3: 22
4: 232
1084900642_1084900649 3 Left 1084900642 11:72307612-72307634 CCTGCATCCCTCTCAATACCCAC 0: 1
1: 0
2: 0
3: 14
4: 217
Right 1084900649 11:72307638-72307660 CCTGCCATTTAGCCAGGCCCTGG 0: 1
1: 0
2: 1
3: 17
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084900642 Original CRISPR GTGGGTATTGAGAGGGATGC AGG (reversed) Intronic
900302382 1:1984513-1984535 GTGGGCAGTGGGAGGGGTGCAGG - Intronic
900643549 1:3698545-3698567 GTGGGCTTTGAGCGGGATCCGGG + Intronic
901129153 1:6951409-6951431 GTGGGGATTGAGTGGGATAATGG + Intronic
902547648 1:17199911-17199933 GTGGGTAAGGAGAGGGGTGGAGG - Intergenic
904402163 1:30263957-30263979 GTGGGTTTGGAGAGAGATGCGGG - Intergenic
904584002 1:31569093-31569115 GTGGGCAGAGAGAGGCATGCAGG - Intergenic
904621073 1:31775672-31775694 TTGGGTGTTGAGAGGGAAGATGG - Intergenic
904772029 1:32886120-32886142 GTGGGTATGGGGAAGGAAGCGGG + Intronic
905977780 1:42191387-42191409 GTTGATGTGGAGAGGGATGCTGG + Exonic
906187488 1:43872198-43872220 GGGTGTATTGAGAGGGGTGTGGG + Intronic
907111352 1:51929189-51929211 GTGGGGAGTTAGAGGGATGATGG - Intronic
907222131 1:52914847-52914869 GTGGGTGATCCGAGGGATGCAGG - Intronic
907550226 1:55298820-55298842 TAGGGTGTAGAGAGGGATGCTGG + Intergenic
908271425 1:62426390-62426412 GCGGGTGCTGAGGGGGATGCAGG - Intergenic
913528295 1:119713858-119713880 GTGGGGATAGGGAGGGATGAGGG + Intronic
915267961 1:154732230-154732252 GTGGCTTATGAGAGGGATGTGGG - Intronic
915512373 1:156393155-156393177 GTGGGGGTTGAGAGGGAGGCTGG - Intergenic
915586006 1:156844364-156844386 GTGAGGATGGGGAGGGATGCGGG + Intronic
916007750 1:160677608-160677630 GTGAGTTTGGATAGGGATGCAGG + Intergenic
918142706 1:181732533-181732555 GTGGGCATTGAGCGGGTTGAGGG - Exonic
919228960 1:194747595-194747617 GTGGGTCTTCAGAGGTTTGCAGG + Intergenic
919754929 1:201060857-201060879 GTGGGTGTGGAGAGGGAGGGAGG - Intronic
920294132 1:204945604-204945626 GGGGGTATTGGGAGGGCAGCAGG - Intronic
922034144 1:221832050-221832072 GTGGGTAGAGGGAGGGATGGAGG - Intergenic
1065331094 10:24600623-24600645 GTGGGTGTTCAAAGGAATGCTGG - Intronic
1065479376 10:26177119-26177141 GTTGGTATAGAGAGGGGGGCTGG + Intronic
1067800266 10:49353786-49353808 GAGGGTGTGGGGAGGGATGCTGG - Intergenic
1068132425 10:52911470-52911492 GTGAGTATTGGCAAGGATGCGGG - Intergenic
1071267922 10:83980804-83980826 GTGTGTATGGAGAGAGATGGGGG - Intergenic
1071798314 10:89029566-89029588 CTGGGAATTGAAAGGGATGGCGG + Intergenic
1072250214 10:93575936-93575958 GTGGGCAGTGGGAGGGATTCTGG + Intronic
1073338827 10:102729901-102729923 GTGGGCATGGGGAGGGCTGCTGG + Intronic
1074410443 10:113223610-113223632 GTGGGTATTGAGTTGGCTGTGGG + Intergenic
1075690600 10:124391482-124391504 GTGGGTATTGAGTGTGAGGCAGG - Intergenic
1077214054 11:1387918-1387940 GAGGGTTGGGAGAGGGATGCAGG + Intergenic
1081067124 11:38557685-38557707 GTGGGAATTGAGAAGGAGGGTGG - Intergenic
1081379198 11:42394489-42394511 GAGGGCATTGAGAGTGATGGAGG + Intergenic
1081929429 11:46858516-46858538 GTGGGTAAAGACAGGGATGAAGG - Exonic
1083303661 11:61752227-61752249 GTGGCTAACGAGAGGGATGGGGG + Intergenic
1084416231 11:69034315-69034337 GTGGGTACAGACAGGGAGGCAGG - Intergenic
1084900642 11:72307612-72307634 GTGGGTATTGAGAGGGATGCAGG - Intronic
1084941467 11:72615492-72615514 GTGGGTAGAGGGAGGGAGGCAGG + Intronic
1085548581 11:77345178-77345200 GTGTGTATTGAGAGGTTTGAGGG + Intronic
1088150759 11:106742331-106742353 GTGGGTAGTGAGTGGAATGAGGG - Intronic
1088325628 11:108598076-108598098 GTGGAGAATGGGAGGGATGCAGG + Intergenic
1089693253 11:120199593-120199615 GTGGGTATTAAGTGGGGTGCTGG + Intergenic
1091187215 11:133657586-133657608 CTGGGTATTCAGAGGGCTTCGGG + Intergenic
1094537880 12:31337964-31337986 GTGGGTGTGCAGAGCGATGCTGG - Intergenic
1095030627 12:37271462-37271484 GTGGGTATTTAGAGGGCTTTGGG + Intergenic
1095184358 12:39184693-39184715 GGGGGTGTTGAGGGGGATGGAGG - Intergenic
1095572320 12:43697412-43697434 GTTGGGGTTGAGAGGGAAGCCGG - Intergenic
1096113464 12:49041867-49041889 GTGGGAACTGAGAGGGAGGGAGG - Intronic
1096244602 12:49977177-49977199 GTTGGTAATGAGAGGGAGGAGGG + Intronic
1096661772 12:53129821-53129843 GTGGGCTTGGAGAGGGATGATGG - Intergenic
1100517459 12:95342182-95342204 GTGGGAATGGAAAAGGATGCTGG - Intergenic
1103949103 12:124541772-124541794 GTGGATATGGAGGGGGATGGGGG + Intronic
1105700533 13:22932850-22932872 GTGCTGATGGAGAGGGATGCAGG + Intergenic
1105853300 13:24354899-24354921 GTGCTGATGGAGAGGGATGCAGG + Intergenic
1106135669 13:26971606-26971628 GTGGGTGTGGAGGGTGATGCTGG + Intergenic
1108025478 13:46172579-46172601 GTGGCTACAGACAGGGATGCAGG + Intronic
1109568897 13:64159569-64159591 CTGAGTCTTGAGAGGAATGCAGG + Intergenic
1114612708 14:24052781-24052803 GTGGGTAGCGAGAAGGAAGCAGG - Intronic
1121231035 14:92358610-92358632 GCAGGTATGGAGAGGGGTGCAGG - Intronic
1121246840 14:92467051-92467073 GTGGGGAGGGAGAGAGATGCAGG - Intronic
1121459855 14:94066312-94066334 GTGGGTGTTGTGGGGGATGGGGG - Intronic
1125269403 15:37921639-37921661 GTGGCTGCTGTGAGGGATGCGGG + Intergenic
1125805201 15:42487914-42487936 TTTGGTATTGAGGGGGATCCTGG - Intronic
1127341547 15:58049998-58050020 GTGGGTCTTGAGGGGGAAGGGGG + Intronic
1127520559 15:59739325-59739347 GTGGGTACTGACAGGGAAGAAGG + Intergenic
1128338610 15:66804289-66804311 GTGAGGCCTGAGAGGGATGCAGG + Intergenic
1128349766 15:66881065-66881087 GTGGGGAATGACAGTGATGCTGG + Intergenic
1129238031 15:74235343-74235365 GTGGGGGTAGAGAGGGAGGCTGG + Intergenic
1129279924 15:74476603-74476625 CTGGGTTTTGAGATGGATGTAGG + Intergenic
1129761836 15:78133392-78133414 GTGGGTATCGAAAGGGTTCCTGG + Intronic
1130108551 15:80946891-80946913 GTGGGCATGGGGAGGGATGTTGG - Intronic
1130193212 15:81755700-81755722 TTGGGCATTGAGAGGGAGGGAGG + Intergenic
1132077144 15:98831312-98831334 GTGGGTGGTGAGATGGATTCTGG - Intronic
1132557010 16:576967-576989 GTGGGTCTTGTGTGGGCTGCAGG + Intronic
1134017491 16:10899224-10899246 GTGGGTTTGGAGAGGGAGGAAGG - Intronic
1136102052 16:28003733-28003755 GTGGGGATTGAGATGGAGACAGG - Intronic
1137488394 16:48910475-48910497 GTGGTTTTTGTGAGGGATGTGGG - Intergenic
1137492782 16:48946706-48946728 TTGTTTATTGAGAGAGATGCAGG + Intergenic
1138155968 16:54703033-54703055 GTGGGTAATGATATGGATGCTGG - Intergenic
1138499187 16:57428353-57428375 GTGAGCATTTAGAGGGAAGCAGG - Exonic
1138509860 16:57502207-57502229 GTGAGTAGTGAGAGGGTTGGTGG + Intergenic
1143376507 17:6470574-6470596 GTGGGTTTTGAGAAGGAAGGAGG - Intronic
1143826541 17:9613207-9613229 GTGGGTATTACGAGGGCTTCTGG + Intronic
1144820521 17:18070079-18070101 GTAGGTATTGAGGGTGATGCAGG + Intergenic
1145995026 17:29100134-29100156 GGGGGCATTGACAGGGTTGCTGG - Intronic
1147222141 17:38941678-38941700 GTGTGTATTGAGAGGGGAGAGGG + Intronic
1147758480 17:42782948-42782970 GTGGGTGGGGAGAGGGAGGCTGG + Intronic
1148104648 17:45112826-45112848 GTGGGGATGGAGAGGGATGTGGG - Intronic
1148351049 17:46942524-46942546 GGGGGGATTGAGAGGTGTGCAGG + Intronic
1150932288 17:69598133-69598155 GTGGAGATTGACAGGGGTGCTGG + Intergenic
1151712073 17:75812697-75812719 GTGGGTGTAGGGTGGGATGCGGG - Intronic
1154989730 18:21589543-21589565 GTTGGGATTGAGAGGTATACGGG - Intronic
1155915721 18:31555129-31555151 GTGGGTATTGAGATAAATGAAGG + Intergenic
1156469034 18:37365987-37366009 GTAGGAATTTAGAGGGAGGCAGG + Intronic
1158554177 18:58461472-58461494 GTGTGTAATGAGAGTGATGAGGG + Intergenic
1162552639 19:11366057-11366079 GGGGGTCCTGAGAGGGATGGGGG + Intergenic
1162851005 19:13431044-13431066 GTGGGAATAGAGGGGGATGGGGG + Intronic
1166125794 19:40714813-40714835 GTGGGTTTTGGGAGGCCTGCAGG - Intronic
1167429459 19:49446253-49446275 GTGGGTGTTGGGAGGGAAGAGGG - Intergenic
1167713157 19:51124667-51124689 AAGGGCATTGAGAGGGAGGCAGG + Intergenic
925150573 2:1612096-1612118 GTGGGAAGGGAGAGGAATGCTGG - Intergenic
929415373 2:41741775-41741797 GTGGGTATAGTAAGGGATGAAGG + Intergenic
931618060 2:64181630-64181652 GTGTGTATGGAGCGGGAGGCAGG + Intergenic
932284265 2:70519143-70519165 GTGGGTATTCAGAGGGCAGCAGG + Intronic
932823486 2:74920801-74920823 CTGGACATTGAGAGGGAGGCAGG - Intergenic
934844671 2:97655193-97655215 GTGGGTCTGGAGAGGAAGGCAGG - Intergenic
936632062 2:114214499-114214521 GTGGATCTTGAGAAGGATGGAGG + Intergenic
937279282 2:120706213-120706235 GTGGGGATTGAGAGGGGGGTAGG - Intergenic
937629046 2:124078796-124078818 GAGTGTCTGGAGAGGGATGCAGG + Intronic
937951456 2:127391009-127391031 CTGGGTGTTGAGAGAAATGCAGG + Intergenic
938164322 2:129012952-129012974 TTGGCTATTGAGAGTAATGCTGG + Intergenic
938482929 2:131676273-131676295 GCAGGTCTAGAGAGGGATGCTGG - Intergenic
940058117 2:149534913-149534935 GTGGGTAATGAGAGGTCAGCGGG - Intergenic
941408310 2:165120041-165120063 GTGGGTCTACAGAGGGATGATGG + Intronic
943048732 2:182890296-182890318 CTGGGTTTTCTGAGGGATGCAGG - Intergenic
943092297 2:183389812-183389834 GTGTGTTTTGAGGGGGCTGCTGG + Intergenic
945848965 2:214982785-214982807 GTGTGTATTGGGAGGGATATAGG + Intronic
946569625 2:221009472-221009494 GTGTGTATGGGGATGGATGCGGG - Intergenic
1168856527 20:1013034-1013056 GTGGGTGGGGAGGGGGATGCAGG + Intergenic
1169012084 20:2259240-2259262 GTGGGGAGTTAGAGGGATCCAGG + Intergenic
1170783637 20:19449069-19449091 GTGGGCAGGGAGAGGGAGGCAGG + Intronic
1174177675 20:48655419-48655441 GGGGTTATTGAGAGTGATGCTGG - Intronic
1174547691 20:51337984-51338006 GTGGGTATTGAGGAGGTTCCTGG - Intergenic
1175754878 20:61523134-61523156 GTGGCTAGGGAGAGGGATGGAGG - Intronic
1178730849 21:35101283-35101305 ATGGGCAGTGAGAGGGATCCTGG - Intronic
1178786324 21:35657029-35657051 GTGTGTATTTGGAGGGATGGAGG - Intronic
1179395062 21:41031958-41031980 CTGGGTCTTGAGAGAGATGCAGG - Intergenic
1181087714 22:20450006-20450028 GTGGGGATGGAGTGGGGTGCGGG - Intronic
1182736130 22:32533145-32533167 GAGGGTCTTGAGAGAGATTCCGG + Intronic
949218954 3:1606596-1606618 GTGGGTTTTGAAAGGGTTACTGG + Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
950942373 3:16905844-16905866 GAGGTAATTGAGAGGGAGGCAGG + Intronic
952430418 3:33218517-33218539 GTGGGCCAGGAGAGGGATGCTGG + Intronic
953789508 3:45936699-45936721 GTGGGTAGAGGGAGGGCTGCAGG + Intronic
955474649 3:59323748-59323770 ATGGGTCTTGACATGGATGCTGG + Intergenic
956529465 3:70201764-70201786 GAGGGAATGGAGAGGGAAGCAGG - Intergenic
957674656 3:83350979-83351001 CTGGGTCTTGAAAGGGTTGCAGG - Intergenic
958772377 3:98440870-98440892 GTGTATATGGACAGGGATGCAGG - Intergenic
960046744 3:113205899-113205921 CTGGGTATTGCAAGGGCTGCTGG - Intergenic
961326373 3:126111774-126111796 GTGGATAGTGGCAGGGATGCGGG - Intronic
966890355 3:184403026-184403048 GTGGGTACGGAGAGGGCTGACGG + Intronic
967847585 3:194056517-194056539 GTGGGTACTGAGTGGGCGGCGGG + Intergenic
969572743 4:8019561-8019583 ATGGGTATTGACAGGCATGCGGG + Intronic
969718306 4:8879041-8879063 GAGGGTCTTGGGAGGGCTGCAGG + Intergenic
969821658 4:9725399-9725421 GTGGCAAGTGAGATGGATGCTGG - Intergenic
973262699 4:48180862-48180884 GTGAGTGTTGACAGGGAGGCTGG + Intronic
973957564 4:56077927-56077949 CTGGGTTTTGAAAGGAATGCAGG + Intergenic
975517251 4:75260306-75260328 GTGGCTGCTGTGAGGGATGCAGG - Intergenic
977117253 4:93045689-93045711 GTGGGAAATGAGAAAGATGCTGG - Intronic
977331207 4:95639856-95639878 TGGGGTATTGAGAGGTTTGCTGG + Intergenic
977550691 4:98439922-98439944 GTGGTTCTGGAGATGGATGCTGG - Intronic
977641637 4:99364061-99364083 AAGGGTAGTGAGAGGGATGGAGG - Intergenic
980739667 4:136932786-136932808 TTGGCTATTGTGAGTGATGCTGG - Intergenic
980869035 4:138589405-138589427 GTGGGTAATGGAAGTGATGCTGG + Intergenic
982643984 4:157999009-157999031 ATGGGTATTGAGAGGCAGACAGG + Intergenic
987086934 5:14479042-14479064 GTGTGTATGGAGAGTGATGGGGG + Intronic
988563711 5:32303417-32303439 GTGGAAATAGAGAGGGATTCTGG - Intronic
990712217 5:58596024-58596046 TTGGCTATTGGGAGGGATGTGGG + Intronic
992193435 5:74316455-74316477 GTGGGCAGTGAGAGAGGTGCTGG + Intergenic
992897028 5:81254499-81254521 GTGGGGAAGGAGAGGGAGGCTGG - Intronic
993480702 5:88421465-88421487 GTGAGGTTTGAGAAGGATGCAGG + Intergenic
994184005 5:96798712-96798734 ATGGGTATTAAGAAGGATGAGGG - Intronic
998103597 5:139454691-139454713 GTGGGCTTTGAGAGGAAGGCTGG - Intronic
998458197 5:142290079-142290101 GTTGGGATTAAGAGGGATGTTGG - Intergenic
999314551 5:150575412-150575434 GTGGGCCTTGAGAGGGTTGGGGG + Intergenic
999911812 5:156209821-156209843 GTGGGTCTTCAGAGGGGTTCTGG - Intronic
1000275590 5:159732156-159732178 ATGGGGAGTGAGAGGGGTGCTGG - Intergenic
1006303820 6:33207579-33207601 GTAGGGAATGAGAGGGATACAGG - Intergenic
1007688130 6:43679623-43679645 GTGGGTTATGAGAGTGAGGCTGG + Intronic
1007935153 6:45726364-45726386 CTGGATATTGAGAAGAATGCTGG + Intergenic
1007982432 6:46172416-46172438 ATGGGGATTAAGAGGGAGGCTGG + Intergenic
1009565861 6:65310428-65310450 GTGGGTACTCAGAGGCAGGCAGG - Intronic
1011292990 6:85795798-85795820 GAGGGAATGGAGAGGGAAGCAGG + Intergenic
1012382118 6:98632492-98632514 GTGCATATGGAGAGGGAAGCTGG - Intergenic
1020498386 7:8885857-8885879 GTGGGGACTGAGAGAGATGATGG + Intergenic
1022225353 7:28357070-28357092 GTGGCTTTAGCGAGGGATGCAGG - Intronic
1022538588 7:31114385-31114407 GGGGGTGTTGGGAGGGATGAAGG + Intergenic
1023664970 7:42513404-42513426 GTGTGTGTGGAGTGGGATGCAGG + Intergenic
1024005144 7:45219806-45219828 GTGGGAAGTGAGAGGGAGGGGGG + Intergenic
1026796527 7:73369427-73369449 GTGGGCATCAAGAGGGAAGCTGG - Intergenic
1028009487 7:85622884-85622906 GTGGGTGGTGAGAGGGATATGGG - Intergenic
1030979841 7:116173599-116173621 GAGGGTGTTGAGAGGGAAGATGG - Intergenic
1032016099 7:128381194-128381216 CTGGGTATTGGGTGGGCTGCTGG + Intergenic
1035968086 8:4216907-4216929 TTGGCTTTTGAAAGGGATGCTGG - Intronic
1038546058 8:28426602-28426624 GTGGGATATGAGTGGGATGCTGG - Intronic
1039460875 8:37743120-37743142 GGTTGTATTTAGAGGGATGCTGG + Intronic
1039561028 8:38512642-38512664 GAGGGGATGGAGAGGGAGGCAGG + Intronic
1039745848 8:40426033-40426055 GAGGGGATTGAGAGGGAGGTAGG - Intergenic
1039904835 8:41779003-41779025 GTGGGGATGGAGAGGGCTGTGGG + Intronic
1040143145 8:43951120-43951142 GTGTGTATATAGAGGGATTCTGG + Intergenic
1040271848 8:45958348-45958370 GTGTGTATATAGAGGGATTCTGG + Intergenic
1040751536 8:50714720-50714742 GTGGGTGTGGAGAGGAAAGCTGG + Intronic
1042146405 8:65734586-65734608 GTGGTTGTTGAGAGAGAGGCTGG - Intronic
1044058606 8:87604266-87604288 GTGTGTGTTGAGAGGGATTTAGG - Intronic
1044938178 8:97313089-97313111 GTGGGGTTTGAGAGAAATGCAGG - Intergenic
1045237036 8:100361261-100361283 GTGGTGATGGAGAGGGAGGCAGG + Intronic
1047631015 8:126708583-126708605 TTGGGGATTGAGAGGGAAGATGG - Intergenic
1048008827 8:130440628-130440650 GTGAGGTTTGAGAGGGAAGCAGG - Intronic
1048256045 8:132906057-132906079 GTGGGGACTGAGTGGGATGTGGG + Intronic
1048802356 8:138206182-138206204 GTGGGTAGTGAAGGGGATGCTGG - Intronic
1049708626 8:144053929-144053951 GTGGGTATTTGGAGGGATTTGGG - Intronic
1050336505 9:4594906-4594928 GTGGGTGTTGAGAAGAATGGAGG - Intronic
1051173623 9:14343515-14343537 GTGGCTGTTGGCAGGGATGCTGG + Intronic
1052790876 9:32874551-32874573 GTGGGTAGGGATAGGGATGGTGG - Intergenic
1055279751 9:74660871-74660893 GTGGGTAGGGCCAGGGATGCTGG - Intronic
1056000067 9:82205828-82205850 GTGGGACTTGACAGGGATGTAGG - Intergenic
1056575603 9:87853967-87853989 GTGGGTCTTGTGAGGGAATCAGG - Intergenic
1057474269 9:95385385-95385407 CTGGGTATTGGGAGTGATGACGG - Intergenic
1058283834 9:103151188-103151210 CTGTGTTGTGAGAGGGATGCAGG + Intergenic
1058456613 9:105143576-105143598 GTGGGTATTGAGAGGGGCACTGG - Intergenic
1059884323 9:118728462-118728484 GCGGGTAGTGATAGGGTTGCAGG + Intergenic
1060294338 9:122332985-122333007 GGGGGGATTGTGAGGGATACTGG + Intergenic
1061211866 9:129198323-129198345 GTGGGGATGGAGTGGGAGGCGGG + Intergenic
1062460883 9:136662146-136662168 GGGGGTGTGGGGAGGGATGCGGG - Intronic
1186474242 X:9844902-9844924 GTGGGAGTTGAGAGGAACGCAGG - Intronic
1189349200 X:40264404-40264426 GTGGGTGTTGAGAGGGGTTGTGG + Intergenic
1190066672 X:47246089-47246111 GAGGGGATGGAGAGGGATGGTGG - Intronic
1190734492 X:53247036-53247058 GTCGGTATTGAGGAGGATGATGG + Exonic
1193581538 X:83269765-83269787 TGGGGTATTGAGAGGGAGGTAGG + Intergenic
1194743759 X:97606377-97606399 GTGGTTATTGGGTGGGAAGCTGG + Intergenic
1195425299 X:104722453-104722475 GAGGATATTGAGAGGGAGACAGG + Intronic
1195615039 X:106905428-106905450 GTGGGGAAAGAGAGGGTTGCTGG + Intronic
1196438448 X:115695366-115695388 GTGGGTATTACGAGGGAAGCGGG - Intergenic
1197132399 X:123020133-123020155 GTGGCTGTTGTGAGGGATGGGGG - Intergenic
1199214923 X:145252540-145252562 GTGGATATTGAGACTGATGAAGG + Intronic
1199243818 X:145579245-145579267 GTGGGTATAGAGATGAATGGGGG - Intergenic
1199972367 X:152870768-152870790 GTGGGGAGTGAGAGGGAGGGAGG + Intergenic
1201078496 Y:10208215-10208237 GTGGCTAGTGAGAGGGAGACAGG + Intergenic