ID: 1084902674

View in Genome Browser
Species Human (GRCh38)
Location 11:72321536-72321558
Sequence GGCTCGCTTTGCTTAGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084902670_1084902674 -4 Left 1084902670 11:72321517-72321539 CCGAGGCGAAGCCTAGCTGGGCT 0: 1
1: 0
2: 1
3: 6
4: 91
Right 1084902674 11:72321536-72321558 GGCTCGCTTTGCTTAGAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084902674 Original CRISPR GGCTCGCTTTGCTTAGAGGT GGG Intronic