ID: 1084902805

View in Genome Browser
Species Human (GRCh38)
Location 11:72322242-72322264
Sequence CTTTAGCAGCAAAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 328}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084902805 Original CRISPR CTTTAGCAGCAAAAGGAGGA TGG (reversed) Intronic
900355350 1:2259142-2259164 CTTTACCCACAAAAGGAGGCAGG - Intronic
901077657 1:6565468-6565490 CTACAGGAGCAAAAGAAGGAGGG + Intronic
901573410 1:10180342-10180364 CTTTAGCAGCAAAATGTCCAAGG - Exonic
901599144 1:10408905-10408927 CTTTAACAGCAACACGAGGCCGG - Intronic
901719838 1:11187903-11187925 CTTTAGCAGGCAAAGGAGGCTGG + Intronic
901807670 1:11748521-11748543 CTTGAGCAGCAAGCTGAGGATGG - Exonic
902228418 1:15011843-15011865 CTTTAGGACCAAAAAGAGGAAGG + Intronic
903155735 1:21441073-21441095 CTCTAGCAGCAAAAGACAGAAGG - Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903651768 1:24926939-24926961 CTTGAGCAGCAGAAGGAAGGCGG - Intronic
903747526 1:25598137-25598159 CTGTAGCAGCAAGAAGAGGCAGG + Intergenic
903934091 1:26882872-26882894 CTGAGGCAGGAAAAGGAGGAGGG - Intronic
904351192 1:29907881-29907903 CTTCAGCAGAAAGAGGAGGTTGG + Intergenic
905140597 1:35840856-35840878 CTTTAGAAGGCCAAGGAGGAAGG - Intronic
905150962 1:35927112-35927134 AGTGAGCTGCAAAAGGAGGAAGG + Exonic
906985896 1:50682848-50682870 CTTTGGGAGGAAAAGGAGGGCGG + Intronic
907044975 1:51295050-51295072 CTGTGGCAGAAATAGGAGGAGGG - Intronic
911484585 1:98489362-98489384 CTTAAGTAGCAATAGGAGAAGGG - Intergenic
911650368 1:100381193-100381215 CTCTGGAAGCAAAAGGAGAAAGG - Intronic
913049400 1:115103794-115103816 CTGTAGCAACACAAGGAAGAAGG - Intergenic
913286341 1:117230066-117230088 CTTGAGCAGCAATGGGTGGAGGG + Intergenic
913706744 1:121433385-121433407 ATTTAGCAGTAAAATAAGGAAGG + Intergenic
914720765 1:150286912-150286934 CATCAGCAGCAACTGGAGGATGG - Exonic
917006498 1:170421095-170421117 CTTTAACAGCAAAAGAAGTTTGG + Intergenic
917047993 1:170884816-170884838 CTTTAGCACCAAAAAAAGTAAGG - Intergenic
919795302 1:201318013-201318035 GTTAAAGAGCAAAAGGAGGAAGG + Intronic
920525523 1:206663376-206663398 CTTTAGTTGCAAAATCAGGATGG - Intronic
920681554 1:208077002-208077024 CTTTCACAGGGAAAGGAGGATGG + Intronic
921217305 1:212949230-212949252 CTTTGGGAGAAAGAGGAGGAAGG - Intergenic
921232773 1:213089756-213089778 CTTTAACAGCAAAATGGGGCCGG - Intronic
921921613 1:220676331-220676353 CTCAAGCAGCAAGAGGAGGTGGG - Intergenic
921968732 1:221121291-221121313 CTTTAGCTCCAAAAGGAAGGGGG - Intergenic
922436346 1:225611218-225611240 CTTTGGGAGCCAAAGGTGGAAGG + Intronic
922887012 1:229028158-229028180 CTTAAGCATCAAAGGGAGGGAGG + Intergenic
923066078 1:230518536-230518558 CTAAACCATCAAAAGGAGGAAGG - Intergenic
923339420 1:232994998-232995020 CTTTATCTGCAAGATGAGGAGGG + Intronic
923858114 1:237866211-237866233 TTATAGTAGCAAAAGGTGGAGGG - Intergenic
924744598 1:246819813-246819835 CTTTAGGAGGCCAAGGAGGAGGG + Intergenic
1063935150 10:11070181-11070203 GTTTAGCAGGCAAAGGAGGAGGG + Intronic
1065070675 10:22021056-22021078 CCTTGGAAGCAAAAGGAAGAAGG + Intergenic
1065115908 10:22482207-22482229 CCTCAGGATCAAAAGGAGGAGGG + Intergenic
1065819294 10:29510575-29510597 CTTTAGCACCAAAGGCAGAAAGG - Intronic
1065953554 10:30673839-30673861 CTTTAGCACCAAAGGCAGAAAGG + Intergenic
1067741382 10:48898254-48898276 CCTGAGCAGCAAAGGGAGTAGGG + Intronic
1069626505 10:69871154-69871176 GTTTAGAAGCAAGAGGAAGAGGG + Intronic
1069946706 10:71991390-71991412 TTTCAGCAGAAAAAGGCGGAGGG - Intronic
1070132097 10:73663389-73663411 CTTATGCAGGAAAAGGAAGATGG - Intronic
1070438039 10:76412827-76412849 ATTTAGCAGCAAAACAAAGAAGG - Intronic
1071192779 10:83121498-83121520 GTTCAGAAGCAAAAGTAGGATGG - Intergenic
1071326004 10:84518953-84518975 TTTTAGGAACAAAAGGAGTAAGG + Intergenic
1072504617 10:96052746-96052768 CATCAGCAGAAAAAGGAGGGAGG - Intronic
1072984584 10:100128697-100128719 CTTTGGCAGGAAGAGGAGGATGG - Intergenic
1074399904 10:113133411-113133433 CTCTATCCTCAAAAGGAGGATGG - Intronic
1074415386 10:113262858-113262880 TTTCAGCAGCACAAGGAGAATGG + Intergenic
1075358073 10:121801821-121801843 CTCTAGCAGGAGTAGGAGGATGG - Intronic
1077958104 11:7043161-7043183 CTGAAGCAGCAAATGGAGAAGGG + Exonic
1079545830 11:21630664-21630686 ATTCAGCAGAAAAAGGGGGATGG + Intergenic
1081376876 11:42369103-42369125 CTTTATCAGCAAAGGGAAAATGG + Intergenic
1081574862 11:44312609-44312631 CTTTAGGAGGCCAAGGAGGATGG + Intergenic
1084617941 11:70248914-70248936 CATCAGGAGCAACAGGAGGATGG - Intergenic
1084902805 11:72322242-72322264 CTTTAGCAGCAAAAGGAGGATGG - Intronic
1085881740 11:80475192-80475214 TTTTAGCATTAAAATGAGGAAGG - Intergenic
1086229886 11:84555842-84555864 CTCTAGCTGCCAAAGGAGAATGG + Intronic
1086278059 11:85155624-85155646 CTTTAGAAGGCCAAGGAGGATGG + Intronic
1088731205 11:112684600-112684622 TTTGATTAGCAAAAGGAGGAAGG + Intergenic
1089249175 11:117144956-117144978 ATTTTTCAACAAAAGGAGGAGGG - Intronic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1090963643 11:131579650-131579672 CCTTGGCAGCAAAATGAGCAAGG - Intronic
1092330021 12:7577794-7577816 CTTTAAAAGCAAGAGGCGGAAGG - Intergenic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1095508339 12:42922353-42922375 CTTTAGCAGTAAAAGATAGAAGG - Intergenic
1097033639 12:56107362-56107384 CTAGAGAAGCAAAAGGAGAAAGG + Intronic
1097835303 12:64266805-64266827 CCTTAGCAGCAAAAGCAAGAAGG - Exonic
1097929095 12:65164849-65164871 CCTTAGCAGCCAAAGCAGGGAGG + Intergenic
1098204230 12:68090272-68090294 CTTTAGCAGATAAAAGAGGTAGG - Intergenic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1098905796 12:76161140-76161162 TTTTAGCATGAAAATGAGGAAGG - Intergenic
1098975170 12:76895132-76895154 CTGTATCTGCAAAAGGAGCAAGG + Intergenic
1101403621 12:104409689-104409711 TGTTAGCAGAAAAAGGAGGAAGG - Intergenic
1103289694 12:119835147-119835169 GTTTATCATCAAAAGGAGAAAGG - Intronic
1105562078 13:21501777-21501799 CTGTGGCAGGAAAAGAAGGAGGG - Intronic
1106702214 13:32242091-32242113 CATTAGCAACAAAAGGGAGATGG - Intronic
1106922960 13:34583982-34584004 CTTTTACAGCTAAAAGAGGAAGG + Intergenic
1108871679 13:54994536-54994558 CTTTATCAGCAAAAGGATTGTGG + Intergenic
1109451069 13:62514871-62514893 CTTCAGTAGCAAAAGGGAGAAGG - Intergenic
1109887361 13:68559324-68559346 TTTTAGCATTAAAATGAGGAAGG - Intergenic
1110684205 13:78352432-78352454 TATTATCAGTAAAAGGAGGAAGG - Intergenic
1113196070 13:107808033-107808055 CTTTAAGAGAAAAATGAGGAGGG + Intronic
1114788016 14:25623331-25623353 CTTCTGCAGCAAAGGGAGGAAGG + Intergenic
1115738761 14:36364606-36364628 CTTTGGCAGCCAAAGCAGGAGGG - Intergenic
1119764054 14:77177245-77177267 CTTTATCAGCAGCATGAGGACGG - Intronic
1120008864 14:79390422-79390444 CTGTAGCAGCAGAAAGAGGTAGG - Intronic
1120097910 14:80409830-80409852 GTTTAAGAGGAAAAGGAGGAAGG - Intergenic
1121551584 14:94806866-94806888 CTCCAGGAGCAAAAGCAGGAAGG + Intergenic
1123795481 15:23766282-23766304 CTTTATCAGCAACATGAAGACGG + Intergenic
1124375844 15:29128210-29128232 CCTTAGCAGCAGAGGGAGAAAGG - Intronic
1125117135 15:36107570-36107592 CTCTAGCTACAAAAGGAGCAAGG + Intergenic
1125311103 15:38378949-38378971 GAGTAGCAGCAACAGGAGGAAGG - Intergenic
1125667306 15:41441524-41441546 CTTTGGCTAAAAAAGGAGGAAGG - Intronic
1125898113 15:43319694-43319716 CTTTGGGAGCACAAGGAGGGAGG - Intergenic
1127512019 15:59651925-59651947 CTTTAGGAGGACAAGGTGGAAGG - Intronic
1127642539 15:60929472-60929494 CTTTTGCAGAACCAGGAGGATGG - Intronic
1127831942 15:62758710-62758732 CTTTAGAAGGAAAAGGAAAAAGG + Intronic
1128256187 15:66198778-66198800 CTCTAGAAACAAAAGGAGGCTGG - Intronic
1129347270 15:74930615-74930637 CTTTGGGAGCCAAGGGAGGAAGG - Intronic
1129368419 15:75071173-75071195 CTTGAGCAGCAAGATGGGGATGG + Intronic
1129600446 15:76995340-76995362 AATCAGCAGCAAAATGAGGAAGG - Exonic
1130416412 15:83698561-83698583 CTTAAGTAGCAAAAGTTGGAGGG - Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1132375345 15:101325047-101325069 CTGTAGGAGCAAAGGCAGGAGGG + Intronic
1134872872 16:17667590-17667612 CCTTGCCAGCAAAAGTAGGAAGG - Intergenic
1136447184 16:30329618-30329640 CTTTAGGAGGCCAAGGAGGAAGG + Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138542761 16:57698441-57698463 CTTTAGAAGGAAAAGGTGGGAGG + Intronic
1140310036 16:73840273-73840295 TTTTAGCAGCAAAAGGACATGGG - Intergenic
1140847399 16:78903561-78903583 CCTAAGTAACAAAAGGAGGAGGG - Intronic
1140970495 16:80007802-80007824 TTTTAGCAGCAGAAGGCGAATGG - Intergenic
1143313595 17:6014054-6014076 CTTTAGGAATAAAAGGAGCAAGG + Intronic
1143767906 17:9149692-9149714 ATCTATCAGCAAAAGAAGGAAGG - Intronic
1144463421 17:15477438-15477460 CTATTACAGCAGAAGGAGGAAGG - Intronic
1145048893 17:19643758-19643780 TTTAAGCTGAAAAAGGAGGATGG + Intergenic
1145772818 17:27505614-27505636 CTTTATCAGTAAAATGGGGATGG + Intronic
1145824648 17:27867633-27867655 CTTCAGAAGCAAAATGAAGAAGG - Intronic
1146501079 17:33364964-33364986 TTTAAGCAAGAAAAGGAGGATGG - Intronic
1147380012 17:40049095-40049117 CTTTAGGAGGACAAGGAAGAAGG + Intronic
1147437093 17:40423223-40423245 CTTTCCCAGCAGAAGGAGGCTGG + Intergenic
1148098170 17:45069200-45069222 CTTTGGGAGGACAAGGAGGATGG - Intronic
1148396885 17:47315521-47315543 CTTTAGGAGGTAAAGGTGGAAGG - Intronic
1149033919 17:52113959-52113981 CTGTAGCAAAAACAGGAGGATGG + Intronic
1149376216 17:56046731-56046753 CTCTAGCTGCAAAAAGATGAGGG + Intergenic
1149507879 17:57211122-57211144 CTTCAGCAGAAAAAGGTGGAGGG + Intergenic
1153413380 18:4818745-4818767 TTTCCTCAGCAAAAGGAGGAAGG - Intergenic
1153415527 18:4841746-4841768 CCTTACCAGTAAAATGAGGATGG + Intergenic
1153691347 18:7597096-7597118 CTTTAGAAGGACAAGGAGGGTGG - Intronic
1155073527 18:22336277-22336299 CTTCAGGTGCAAAGGGAGGAGGG + Intergenic
1157487161 18:48096155-48096177 TTTTAGCAGGAAAAGGAAAAAGG + Intronic
1158144409 18:54295378-54295400 GTTTAGCAGGCAAAAGAGGAAGG - Exonic
1158353675 18:56592327-56592349 CTTTAAAAGCAAAAGGGGCAAGG + Intergenic
1159934283 18:74349986-74350008 GTATAGGAGCACAAGGAGGAGGG + Intronic
1160096998 18:75882997-75883019 CTTTACCAGCAAAAGGATTATGG - Intergenic
1162539004 19:11282347-11282369 CTTTAGGAGGCAAAGGAGGGCGG - Intergenic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1164406815 19:27955909-27955931 GTTTTGCAGCAGAAGGAGCAGGG + Intergenic
1165357115 19:35311086-35311108 CTTTAGGAGGCCAAGGAGGAAGG + Intronic
1165930537 19:39355537-39355559 CTTTGGCAGCCAGAGGGGGATGG + Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
925111349 2:1341076-1341098 CTTTGGCTGCCAAGGGAGGATGG + Intronic
927304425 2:21554283-21554305 CTTTATCAGCAAAATGAAAATGG + Intergenic
930545028 2:52756641-52756663 CTTTAGGAAGAAAAGGACGATGG - Intergenic
930678399 2:54229597-54229619 CTTTCACAGAAAAAAGAGGATGG - Intronic
931944472 2:67289666-67289688 CTATACCAGCTAAAGGTGGAAGG - Intergenic
932082259 2:68725773-68725795 TGTTCACAGCAAAAGGAGGAAGG - Intronic
932568791 2:72925690-72925712 CTTTAGCAGCCAGAGTAGGAAGG + Intronic
934765528 2:96878162-96878184 GTTGAGGAGGAAAAGGAGGATGG + Intronic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935829012 2:106979780-106979802 CTATAGAAGCAAAGAGAGGAGGG + Intergenic
936393782 2:112102119-112102141 CTTTAGAAGGTAAAGGAGGTGGG + Intronic
936757712 2:115734947-115734969 CATTAACAGCCAAAGGGGGAAGG + Intronic
937941021 2:127286149-127286171 GCTGAGCAGCAAAAGGAAGATGG + Intronic
940307126 2:152238539-152238561 CTTTGGGAGGACAAGGAGGAAGG + Intergenic
941466980 2:165839536-165839558 CATTTGCAGAAAAAGGAAGAAGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941929547 2:170926326-170926348 CTTTAGCAGCAGTTGGTGGAGGG - Intergenic
942977553 2:182037099-182037121 CTCTAGGAGCAAAAAGAAGAAGG + Intronic
946281384 2:218668202-218668224 GTGTGGCAGCAAAGGGAGGAAGG - Intronic
947453978 2:230236242-230236264 CTGTAACTGCAAAAGGAGGGTGG - Intronic
947783639 2:232794134-232794156 CTTAAGAAGGAAAAGGGGGATGG - Intronic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948566698 2:238891809-238891831 CTCTAGGAGCAAACAGAGGAAGG - Intronic
1169112378 20:3042628-3042650 CTTCAGCAGCCAAGGCAGGATGG - Intergenic
1170116160 20:12862413-12862435 CTGTAGCAGGCAAAGGTGGAAGG - Intergenic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1171364905 20:24617056-24617078 CTTAAGCAGCTACAGGAAGAGGG - Intronic
1173856850 20:46255724-46255746 CTGGAGCAGGAAAAGGAAGAAGG - Intronic
1175941058 20:62537701-62537723 CTTTAGCAGGGAAGGGAGGAAGG + Intergenic
1178372487 21:32037876-32037898 TTTTAGCATTAAAATGAGGATGG - Intronic
1178701625 21:34838392-34838414 TCTTAGCAGAAAAATGAGGAAGG + Intronic
1179410992 21:41163082-41163104 CTTGAGGAGCAAAATGAGGCAGG + Intergenic
1179487799 21:41722119-41722141 GTTGAGGAGGAAAAGGAGGAGGG - Intergenic
1180044745 21:45300089-45300111 CGTTAGCGGCAAAAGCAGGCGGG + Intergenic
1180858448 22:19062928-19062950 CTTTAACTTCAAAAGGAGGCGGG + Intronic
1181887972 22:26036753-26036775 GTTCTGCAGCAAAAGGTGGAAGG + Intergenic
1182302824 22:29347368-29347390 CTTTCGTAGCAAGAGGATGAGGG + Intronic
1182639427 22:31754414-31754436 CATTGGCAGCAAAACGAGAATGG + Intronic
1183172310 22:36197406-36197428 CTTCTTCACCAAAAGGAGGAAGG + Intronic
1183180950 22:36259338-36259360 CTTCTTCACCAAAAGGAGGAAGG - Intronic
950431015 3:12951177-12951199 CTTTAGGAGGCCAAGGAGGATGG + Intronic
950656064 3:14437097-14437119 CTTTATCAGCACAGGAAGGATGG + Intronic
951615468 3:24538526-24538548 CTTAAGCAGCATTAGGTGGAGGG + Intergenic
951678626 3:25271109-25271131 TTTTAGCATCAAAATGAGGTTGG + Intronic
952065117 3:29560410-29560432 ACTTAGCAACAAAAGTAGGATGG + Intronic
952258873 3:31720246-31720268 CTTTGGCAGTAGTAGGAGGAGGG - Intronic
953038361 3:39233182-39233204 TTTTAGCATTAAAATGAGGAAGG - Intergenic
953336447 3:42098360-42098382 CTTTTCCAGCACATGGAGGAAGG + Intronic
953567073 3:44041997-44042019 CAATAACAGCCAAAGGAGGAGGG + Intergenic
953999253 3:47543000-47543022 CTTCTGCAGCGAAGGGAGGAGGG + Intergenic
954079671 3:48206330-48206352 CTTAAGCAGCCAGAGGAGCAGGG + Intergenic
954417721 3:50402023-50402045 TTTTAACATCAAGAGGAGGAAGG + Intronic
954423008 3:50428513-50428535 CATTAGCAGCAAAAGCAGGGCGG + Intronic
956012095 3:64842801-64842823 CTTTAGAAGGAAAAGGTGGAAGG + Intergenic
957221060 3:77382718-77382740 CTTTTGCAGCAAATGGATGGAGG - Intronic
957354448 3:79063267-79063289 CATAACCAGCAAAAGGAGAATGG - Intronic
957477310 3:80741146-80741168 CTTTGACATCAAAAGGAAGAGGG + Intergenic
957540816 3:81566661-81566683 ATTTGAGAGCAAAAGGAGGAAGG - Intronic
957873924 3:86120625-86120647 CTTTATCAGCAACATGAGAACGG - Intergenic
959547988 3:107620538-107620560 CTTTAGCAGCATGAAGAGGATGG + Intronic
960484541 3:118235374-118235396 ATTTAGCAGAAAGAGAAGGAGGG - Intergenic
961106918 3:124250172-124250194 CTTAAGGAGAAAGAGGAGGAGGG + Intronic
962366727 3:134791682-134791704 CTTCAGCAGGAAAAGAAGGAGGG - Intronic
962599382 3:136979450-136979472 CTGTAACAGCAAAGGGAGGCAGG + Intronic
962662983 3:137623871-137623893 TTTTAGCATTAAAATGAGGAAGG - Intergenic
964779177 3:160316150-160316172 CTTTAGCAGAGCAAGCAGGAAGG - Intronic
966509810 3:180749322-180749344 CTTTAAGAGCAGAAGGAGGGTGG + Intronic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
968927760 4:3558867-3558889 ATTTATCAGCAAAAAGAGAAGGG + Intergenic
969444696 4:7237907-7237929 ATTTAGAAGCAAAAGGAAAACGG - Intronic
970777356 4:19691515-19691537 CTTTGGCAGCCAAAGCAGTATGG + Intergenic
971655250 4:29336006-29336028 TTATAGAAGAAAAAGGAGGAAGG - Intergenic
971925730 4:33007164-33007186 TTTTAGCATTAAAATGAGGAAGG - Intergenic
973160570 4:47011174-47011196 CATTAGCAGAAAAAGGTGGGAGG + Intronic
973600298 4:52535999-52536021 CTTTATCAGCAAGACCAGGAAGG - Intergenic
974558112 4:63478613-63478635 CTTTAGGAGGCCAAGGAGGATGG + Intergenic
976814032 4:89125889-89125911 TTTTAGCATTAAAAGGAGGAAGG - Intergenic
978213820 4:106172858-106172880 CTTTAGCAGAAATAGAAGGTGGG - Intronic
978570847 4:110135308-110135330 CTTTATCTGCAAATGGGGGATGG - Intronic
979040232 4:115781855-115781877 TTTTAGCATTAAAATGAGGAAGG + Intergenic
979293373 4:119002734-119002756 CTTAGGAAGCAAATGGAGGAAGG - Intronic
979295754 4:119031040-119031062 GTTTTGGAGCAACAGGAGGAGGG - Exonic
984223028 4:177001370-177001392 CTGTAGGAGTAAAAGGAGGGTGG + Intergenic
986703607 5:10435959-10435981 CTTTGGGAGCCCAAGGAGGACGG - Exonic
987137890 5:14916879-14916901 CTTTATCAGCAGCAGGAGAATGG + Intergenic
987773752 5:22337717-22337739 CTTTAGCAGCAATGTGAGAATGG + Intronic
987797439 5:22647228-22647250 CTTTAGCAGGAAAGGGAGGAAGG + Intronic
988445401 5:31280740-31280762 CTTTAACTGAAAGAGGAGGAGGG + Intronic
988815088 5:34826766-34826788 CTGTTGCAGAAAAAGGAGAAGGG - Intronic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
990370335 5:55111519-55111541 TTTTAACTGCAAAAAGAGGATGG + Intergenic
990601826 5:57366770-57366792 CTTGAGCAGGAAGAGGAGGAAGG + Intergenic
990611036 5:57457083-57457105 CTTTATCAGAAAAAGGATGTAGG - Intergenic
990708654 5:58558374-58558396 CTTGATCAGAAGAAGGAGGAAGG - Intergenic
991580377 5:68148582-68148604 CTTTAGCAGTTAAAAGATGAGGG - Intergenic
992588708 5:78270854-78270876 CTACAGAATCAAAAGGAGGAGGG - Intronic
992588873 5:78272463-78272485 CTTCAGAATCTAAAGGAGGAGGG - Intronic
993390359 5:87313377-87313399 CTTTACCAAGAAAAAGAGGAAGG + Intronic
997806369 5:136922152-136922174 CTTTGGCAGGAAAAGAAGGAAGG + Intergenic
998688768 5:144562241-144562263 CTATATCAACAAAAGGAGCATGG - Intergenic
999683821 5:154084697-154084719 CTTAATCAGCAAAATGGGGATGG - Intronic
1000380373 5:160623555-160623577 CTTTGGAAGAAAAAAGAGGACGG + Intronic
1000659093 5:163916724-163916746 CTTTAGCATTAAAATGAGGGAGG - Intergenic
1001852500 5:174981700-174981722 CTTTAGCAGCAGGAGGAAGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1005572387 6:27157780-27157802 CTTTGGCAACAAAAGGAAGAGGG - Intergenic
1005854517 6:29850591-29850613 CTGCAGCAGCGACAGGAGGAGGG - Intergenic
1006016737 6:31087278-31087300 TTTTAGCAGGAAAAGGAGGGGGG - Intergenic
1007239784 6:40416725-40416747 CCCTAGCAGGAGAAGGAGGAAGG - Intronic
1007699131 6:43755779-43755801 CCACAGCAGCAAAAGGAAGATGG + Intergenic
1008250623 6:49235448-49235470 CTTCATGAGAAAAAGGAGGAAGG - Intergenic
1008546151 6:52585469-52585491 CTTTAGAAGCAAAGAAAGGAAGG + Intergenic
1008702979 6:54124075-54124097 CTTTAAAAGCCAAGGGAGGAAGG - Intronic
1009042287 6:58193495-58193517 CTGTTGCAGGAAAAGCAGGAAGG + Intergenic
1009218126 6:60947715-60947737 CTGTTGCAGGAAAAGCAGGAGGG + Intergenic
1010485581 6:76408729-76408751 CTTTAGCAATCAAAGGAGCATGG - Intergenic
1011135323 6:84093771-84093793 TTTTAGCATTAAAATGAGGAAGG + Intergenic
1013119069 6:107125498-107125520 GTTTAGCAGCAAAAGCACAAAGG + Intergenic
1013299882 6:108794996-108795018 CTTTGGGGACAAAAGGAGGAAGG + Intergenic
1013706992 6:112848025-112848047 CTTTCTCAGCAAATGGAGCAAGG + Intergenic
1013963745 6:115930385-115930407 CTCTAGCTGCAAAAGAGGGAGGG + Intergenic
1014587969 6:123224413-123224435 CTTTAGGAGTCAGAGGAGGAGGG - Intronic
1014966640 6:127761486-127761508 TTTTAGCATTAAAATGAGGAAGG - Intronic
1015750774 6:136556255-136556277 CTTTAGGAGGCTAAGGAGGACGG + Intergenic
1015804758 6:137097640-137097662 CTTTGGCAGCAAAATGTGGCTGG + Intergenic
1016078613 6:139828607-139828629 CTTCAGAAGGAAAAGAAGGAAGG - Intergenic
1016124035 6:140376654-140376676 CTTTATAAGCCAAAGAAGGAAGG - Intergenic
1016505412 6:144773432-144773454 CTTTGGTAGGAAAAAGAGGAAGG - Intronic
1016566665 6:145462835-145462857 CATTTGGAGCAAAAGCAGGAAGG - Intergenic
1017085023 6:150705720-150705742 CCTCAGGAGCATAAGGAGGAGGG - Intronic
1017823240 6:158063949-158063971 CTTTAGCGGCAAGATGAGGGTGG + Intronic
1018115168 6:160576232-160576254 CTTGAAGAGCAAAAGCAGGAAGG - Intronic
1018116272 6:160589018-160589040 CATGAGGGGCAAAAGGAGGAAGG - Intronic
1018147517 6:160906424-160906446 CTTGAGGAGCAAAAGTAGGAAGG + Intergenic
1018282406 6:162200845-162200867 CTTTGGCAGCAAAAAGAGGTTGG - Intronic
1019412727 7:913592-913614 TTTGAGCAACAAAAGGAAGATGG - Intronic
1019682208 7:2356875-2356897 TTTTAGCATGAAAAGCAGGAAGG + Intronic
1020331181 7:7018426-7018448 GTTTACAATCAAAAGGAGGAGGG - Intergenic
1020516166 7:9122433-9122455 CTTTGGCAGAGAAAGGAGAAAGG - Intergenic
1020756705 7:12211682-12211704 CATCAACAGCAAAAGGAAGAGGG - Intronic
1021063818 7:16147237-16147259 CTTTATTAGCAACATGAGGATGG + Intronic
1023501496 7:40854818-40854840 CTTTAGCTTCAAAAGTAGGTAGG - Intronic
1023824932 7:44002624-44002646 CTTTTGCTGGAAAAGGAAGATGG + Exonic
1024987117 7:55205103-55205125 CTTTTGCAGCAACAGCAAGAGGG + Intronic
1025010308 7:55391838-55391860 CTTCTGCAGCAAATGGAAGAAGG + Exonic
1026088483 7:67281408-67281430 CTTTTGCTGGAAAAGGAAGAGGG + Intergenic
1026110335 7:67454309-67454331 CTTTACCATCCAAAGGAGGGGGG + Intergenic
1026476486 7:70740394-70740416 CTGAAGCAGCAAAGGAAGGAAGG - Intronic
1026725769 7:72868944-72868966 CTTTTGCTGGAAAAGGAAGATGG - Intergenic
1027118083 7:75496708-75496730 CTTTTGCTGGAAAAGGAAGATGG + Intergenic
1027273721 7:76538760-76538782 CTTTTGCTGGAAAAGGAAGAGGG - Intergenic
1027327170 7:77057811-77057833 CTTTTGCTGGAAAAGGAAGAGGG - Intergenic
1028005492 7:85560966-85560988 ATTTAGCAGCAAAGCCAGGAGGG + Intergenic
1029396000 7:100309008-100309030 CCTTGGCTGCAAAAGGAAGAGGG + Exonic
1029396223 7:100310394-100310416 CCTTGGCTGCAAAAGGAAGAGGG + Exonic
1029396449 7:100311784-100311806 CCTTGGCTGCAAAAGGAAGAGGG + Exonic
1029396673 7:100313174-100313196 CCTTGGCTGCAAAAGGAAGAGGG + Exonic
1029396898 7:100314566-100314588 CCTTGGCTGCAAAAGGAAGAGGG + Exonic
1029589490 7:101497735-101497757 CTTTGGCAGCCCAAGGTGGAAGG + Intronic
1029719419 7:102353332-102353354 CTTTTGCTGGAAAAGGAAGATGG - Intergenic
1029753195 7:102555934-102555956 CTTTTGCTGGAAAAGGAAGATGG + Exonic
1029771147 7:102655018-102655040 CTTTTGCTGGAAAAGGAAGATGG + Exonic
1030196448 7:106858109-106858131 ATGTAGCAGGAAAAGGAGGGTGG + Intergenic
1030354650 7:108528477-108528499 CTTTAGGAGGACAAGGTGGAAGG - Intronic
1034446492 7:151116511-151116533 CTGGAGCAGGAAGAGGAGGAAGG + Intronic
1036180882 8:6584218-6584240 ATTTAGCAGCTCAGGGAGGAAGG + Intronic
1036912549 8:12769253-12769275 CTTTTGGAGAAAAAGAAGGAAGG - Intergenic
1037665137 8:20962607-20962629 CCTTTGCAGAAAGAGGAGGAGGG + Intergenic
1038306676 8:26409818-26409840 CTTCAACAGCAAAAGCAGAAGGG - Intronic
1038727106 8:30091533-30091555 CTTTGGCAGCAAATGGAGCAAGG - Intergenic
1039571035 8:38586408-38586430 TTTCAGCAGAAAAAGGAGGCTGG + Intergenic
1039884342 8:41646755-41646777 GTTTAGCTGTAAAAGCAGGATGG - Intronic
1040859916 8:51988554-51988576 TTTTAGCATCAAAAAGAGGTGGG - Intergenic
1041009369 8:53526584-53526606 CTTCACCAGCAAAAAGATGATGG + Intergenic
1041905767 8:63031907-63031929 CTTTAGCAGCATGAAAAGGATGG + Intronic
1042134639 8:65621276-65621298 CATTAGCAGCAACAGGATGAGGG + Intronic
1042146713 8:65737282-65737304 CATTAGCGGCAACAGGATGAAGG + Intronic
1044866881 8:96580257-96580279 CTTTAGCCTCCAAAGCAGGAGGG + Intronic
1044928941 8:97233535-97233557 CTTCATCAGTAAAACGAGGACGG + Intergenic
1045976569 8:108136425-108136447 CTTTAGGAGCAAAAAGAGGGAGG + Intergenic
1046939088 8:119913936-119913958 ATTTAGAAGGAAAAGCAGGAGGG - Intronic
1047350305 8:124067296-124067318 CCATTGCAGCAAAAGGAGGGAGG - Intronic
1048073524 8:131043497-131043519 ATTCAGCAGCAAAAGGAGGCGGG + Intergenic
1048234524 8:132676425-132676447 CATTTGCAGAAAAAGGAGGGGGG + Intergenic
1048557466 8:135494576-135494598 CTCAAGAAACAAAAGGAGGAGGG - Intronic
1049166176 8:141127930-141127952 ATTCAGCAGGAAAAGGAGCAGGG - Intronic
1049480971 8:142822492-142822514 TTTTAGCATTAAAATGAGGAAGG + Intergenic
1050251992 9:3754373-3754395 CTCTAGCAGTAAATTGAGGAAGG + Intergenic
1050424542 9:5500176-5500198 GTTTAGCATAAAAAGGAAGAGGG + Intergenic
1050914308 9:11112030-11112052 CTTTGGCAGGCCAAGGAGGATGG - Intergenic
1051238155 9:15023637-15023659 CTTGAGTAGGGAAAGGAGGATGG - Intergenic
1051341126 9:16111790-16111812 CTTTTTCAGCAAAAGAAGCAAGG - Intergenic
1051542182 9:18231963-18231985 CTTTAGGAGCAAGGTGAGGATGG - Intergenic
1051882743 9:21856628-21856650 CTTTAGTAGCCAAATGAGGTTGG + Intronic
1057909182 9:99004917-99004939 GTTTAGCAGCAACAGCAGCAGGG + Exonic
1059166182 9:112078412-112078434 CTTTAACAGGGAGAGGAGGAAGG - Intronic
1060101500 9:120844235-120844257 CTTTTGCCCCAAAAGTAGGAAGG - Intergenic
1060962660 9:127692000-127692022 CTAAAGCAGCAAATGCAGGAAGG + Exonic
1062002502 9:134223778-134223800 CTTCAGAAGCAAAGGGACGAGGG - Intergenic
1185719687 X:2371765-2371787 CTTTTGCAATAAGAGGAGGAGGG - Intronic
1186024536 X:5294896-5294918 CTTTGGGAGAGAAAGGAGGAAGG + Intergenic
1186301677 X:8205884-8205906 ATGTAACAGCAAAGGGAGGATGG - Intergenic
1187919557 X:24187869-24187891 CTTTAGAAGCACTAAGAGGATGG + Intronic
1191842830 X:65525153-65525175 CTGAAGCAGCATAGGGAGGAGGG + Intronic
1191849040 X:65572012-65572034 CTTTCCCAGCAAGGGGAGGAGGG - Intergenic
1191952998 X:66614928-66614950 ATTTTGAAGGAAAAGGAGGAAGG - Intronic
1192298853 X:69879695-69879717 CTTTAAGAGGAAAAGGAAGATGG + Intronic
1193005315 X:76611562-76611584 CTATAGTAGCAAAAGAAGCATGG + Intergenic
1196267485 X:113667429-113667451 CATTATTAGCAAAAGGAGGGTGG + Intergenic
1197150048 X:123210192-123210214 TTTAGGAAGCAAAAGGAGGATGG - Intronic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1201261335 Y:12161691-12161713 CTTTAGCAGCAGAATGAAAACGG - Intergenic
1201900535 Y:19043183-19043205 CTGTAGCTGCAAAAGGACAAGGG - Intergenic