ID: 1084912000

View in Genome Browser
Species Human (GRCh38)
Location 11:72397296-72397318
Sequence TATTCATGACCACCAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 905
Summary {0: 1, 1: 0, 2: 47, 3: 153, 4: 704}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084912000_1084912001 4 Left 1084912000 11:72397296-72397318 CCAGTTTTTGGTGGTCATGAATA 0: 1
1: 0
2: 47
3: 153
4: 704
Right 1084912001 11:72397323-72397345 TGCTATAAATATTTACATACAGG 0: 1
1: 3
2: 59
3: 247
4: 931

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084912000 Original CRISPR TATTCATGACCACCAAAAAC TGG (reversed) Intronic
901135517 1:6991163-6991185 TATTCATAATAGCCAAAAACTGG - Intronic
901960190 1:12820296-12820318 TATTCATAATCACTAAAACCTGG + Intergenic
902018386 1:13326945-13326967 TATTCATAATCGCCAAAACCTGG - Intergenic
902266184 1:15266997-15267019 TATTCATAATTGCCAAAAACTGG - Intronic
902390423 1:16101118-16101140 TGTTCATGATAACCAAAAAGTGG + Intergenic
902673087 1:17988787-17988809 TATTCATACTCATCAAAAACTGG - Intergenic
903385160 1:22921259-22921281 TATTTATGACCACAGGAAACAGG - Intergenic
903404270 1:23083286-23083308 TATACATGGCCCCCAAAAACTGG - Exonic
904067786 1:27767944-27767966 TATTCGTAATAACCAAAAACTGG - Intergenic
904537975 1:31213640-31213662 TATTCATGGCAGCCAAAAAGTGG + Intronic
905316671 1:37086175-37086197 TATTCATAACAGCCAAAAAGTGG - Intergenic
905327209 1:37162327-37162349 TATTCATGACAGTCAAAAAGTGG - Intergenic
905487572 1:38314374-38314396 TATTCACAATCTCCAAAAACTGG - Intergenic
905498274 1:38414260-38414282 TATTCATAATCACCAAAACCAGG + Intergenic
906455222 1:45990003-45990025 TATTCGTGATCGCCCAAAACTGG - Intronic
908122169 1:60996341-60996363 TATTCATAATAACCAAAAAGTGG + Intronic
908215021 1:61942979-61943001 TATTCATAATAGCCAAAAACTGG + Intronic
908865462 1:68544069-68544091 TATTCATAGGCACCAAAAGCTGG + Intergenic
908999019 1:70196153-70196175 TATTCATAACAGCCAAAAACTGG + Intronic
908999575 1:70202258-70202280 TATTCATAACTGCCAAAAACTGG + Intronic
909196131 1:72626583-72626605 CATTCATGAAAGCCAAAAACAGG - Intergenic
909252349 1:73375032-73375054 TATTCATAATCACCAAAAATTGG + Intergenic
909352112 1:74666045-74666067 CATTGATGACCATCAAAAAAGGG + Intronic
909645631 1:77913805-77913827 TATTCATAAACACCAAAACTTGG + Intronic
910273458 1:85421859-85421881 TATTCATAATCACCAAAAACTGG - Intronic
910893932 1:92047657-92047679 TATTCTTCACCACCACACACTGG - Intronic
911112146 1:94200609-94200631 TATTCATAATCACCCCAAACTGG + Intronic
911132365 1:94402218-94402240 TATTCATAACCTCCTAAAACTGG - Intergenic
911249956 1:95564136-95564158 TATTCATAATAGCCAAAAACTGG - Intergenic
911366264 1:96941698-96941720 TATTCATAAGAACCAAAAACTGG - Intergenic
911491675 1:98577198-98577220 TATTCATAATCACCAATAACTGG + Intergenic
911580499 1:99628122-99628144 TATTCATAACAACCGAAAAGTGG + Intergenic
911866355 1:103028391-103028413 TATTCATGACCACCACACGGAGG - Intronic
912020479 1:105103124-105103146 TATTCATAATCATCAAAAACTGG - Intergenic
912882019 1:113424698-113424720 TATTCATAATAGCCAAAAACTGG - Intronic
913002801 1:114598189-114598211 TATTCATAACAACCTCAAACTGG + Intronic
913313668 1:117531286-117531308 CATTCATAATAACCAAAAACTGG - Intergenic
913441016 1:118897665-118897687 AATTCATGACCATCAAAGACGGG + Intronic
913514570 1:119592884-119592906 TATTCATGATTATCAAAACCTGG + Intergenic
914015902 1:143818301-143818323 AATGCATGAGCCCCAAAAACTGG + Intergenic
914161881 1:145142707-145142729 AATGCATGAGCCCCAAAAACTGG - Intergenic
914654519 1:149726842-149726864 AATGCATGAGCCCCAAAAACTGG + Intergenic
914978624 1:152391638-152391660 TATTCATAACAACCAAAAGGTGG - Intergenic
916767387 1:167874683-167874705 TATTCATAAGAACCAAAAACTGG + Intronic
917205523 1:172566838-172566860 TATGCATGCCCACATAAAACAGG - Intronic
917233922 1:172869929-172869951 TATTCATAATCACCCAAAATTGG + Intergenic
917341906 1:173988505-173988527 TATTCATGATTGCCAAAAAATGG - Intronic
917352518 1:174092942-174092964 TATTCACAAAAACCAAAAACTGG - Intergenic
917658637 1:177154927-177154949 TATTCATAATTGCCAAAAACTGG + Intronic
917809016 1:178639427-178639449 TATTCATAATCACCAGAAGCTGG - Intergenic
918025249 1:180737872-180737894 TTTTCATAATCACCAAAAACTGG - Intronic
918122605 1:181552591-181552613 TATTCATAATCACCCCAAACTGG - Intronic
918312639 1:183296244-183296266 TATTTATAATCACTAAAAACTGG - Intronic
918403090 1:184183923-184183945 TATTCATGATAGCCAAAATCTGG + Intergenic
918436695 1:184521348-184521370 TATTCATAATCACCAAAAACTGG + Intronic
918488237 1:185052286-185052308 TATTCATGATACCCAAAAAATGG + Intronic
918626934 1:186666744-186666766 TATTCATGATAGCCAAAAGCTGG - Intergenic
918681037 1:187354107-187354129 TATTCATGATTGCCAAAACCTGG + Intergenic
919049568 1:192497824-192497846 AATTCATTACTGCCAAAAACTGG + Intergenic
919673473 1:200358804-200358826 TATTCATAATAACCAAAAAGTGG - Intergenic
920909695 1:210204646-210204668 TATTTATAATCACTAAAAACTGG - Intergenic
921124339 1:212163551-212163573 TAATCATTATCACCATAAACTGG + Intergenic
921229596 1:213055491-213055513 TATTCATAATGTCCAAAAACTGG - Intronic
921603221 1:217129509-217129531 TATTCATAATAACCAAAAAGTGG + Intronic
921792918 1:219310258-219310280 TATTCATCACCCCCATAAATAGG - Intergenic
922403554 1:225286794-225286816 TATTCATAATCACCAAAAACTGG + Intronic
923098057 1:230791149-230791171 TATTCATAATGACCAAAAACCGG - Intronic
923169563 1:231401749-231401771 TATTCATTATCACCAAAAATAGG - Intronic
923390024 1:233505222-233505244 TATTCATAACAGCCAAAAAGTGG - Intergenic
923660558 1:235953454-235953476 TATTCATAATTACCAAAACCTGG - Intergenic
923828244 1:237524126-237524148 TATTCATAAGAGCCAAAAACTGG + Intronic
923830718 1:237552806-237552828 TATTCATAATCACCTAAAATTGG - Intronic
924179073 1:241423684-241423706 TATTCATAATAGCCAAAAACTGG - Intergenic
924417484 1:243872341-243872363 TATTCATCATAACCAAAATCTGG - Intergenic
1063844034 10:10105349-10105371 CATTCATAATCACCAAAAACTGG + Intergenic
1064772632 10:18739543-18739565 AATTCATAAACACTAAAAACTGG - Intergenic
1064828600 10:19435481-19435503 CTCTCATGATCACCAAAAACAGG - Intronic
1064875385 10:19988039-19988061 TATTCATGACTAACAAAGGCTGG - Intronic
1065170261 10:23020052-23020074 TATTCATAATCAACAAAAACTGG - Intronic
1065238170 10:23676287-23676309 TATTCATAATCACCAAAAACTGG - Intergenic
1065389198 10:25164822-25164844 TGTTCATGACAGCCAAAAACTGG - Intergenic
1065505278 10:26424338-26424360 TATTCATAATGACCAAAAACTGG + Intergenic
1065615556 10:27518160-27518182 TATTCATAATCACTAAAAACTGG - Intronic
1065948815 10:30632808-30632830 TATTCATAATCACTAAAAAATGG + Intergenic
1065980289 10:30888053-30888075 AATTCATGATAACCAAAAACTGG - Intronic
1066078001 10:31900420-31900442 TATTAATAACCAACAAAAACTGG + Intronic
1066649896 10:37644358-37644380 TATTCATGATATCCAAAGACTGG - Intergenic
1066684688 10:37969336-37969358 TATTCATAATAACCAAAAAGTGG + Intronic
1067401531 10:45978854-45978876 TATTCATAATAACCAAAAAATGG + Intronic
1067856551 10:49798526-49798548 TATTCATAACCACGAAAACCTGG + Intergenic
1067869882 10:49948434-49948456 TATTCATAATAACCAAAAAATGG + Intronic
1068324822 10:55471086-55471108 TATTCATAACTACCAAAACTTGG - Intronic
1068326531 10:55495799-55495821 TATTCATGATAACCAAAGAATGG + Intronic
1068342462 10:55724332-55724354 TATTCATAATCGCAAAAAACTGG + Intergenic
1068450482 10:57179947-57179969 TATTCATAATAACCAAAAACAGG - Intergenic
1068523516 10:58103462-58103484 TATTCATAATCACCAAAAAATGG + Intergenic
1068716489 10:60194675-60194697 TATTCATGACAGCCAAAAGGTGG - Intronic
1068925935 10:62538383-62538405 TAGTCATAAGTACCAAAAACTGG + Intronic
1068931934 10:62599603-62599625 TGTTCATAATCACCAAAAGCTGG + Intronic
1069022773 10:63507186-63507208 TATTCATAATCACCAAAACTTGG - Intergenic
1069182457 10:65378880-65378902 TATTCATAATCACCCAAATCTGG + Intergenic
1069240065 10:66128360-66128382 TATTCATAACTGCCAAAAATTGG + Intronic
1069766004 10:70860812-70860834 TATTCATGATAGCTAAAAACTGG + Intronic
1070243805 10:74711022-74711044 TATTCATCATTGCCAAAAACTGG + Intergenic
1070316997 10:75323291-75323313 TATTTATAAATACCAAAAACTGG - Intergenic
1070405973 10:76095397-76095419 TATTCATAATCACCAAAATCTGG - Intronic
1070840228 10:79481301-79481323 TATTCATAATTGCCAAAAACTGG + Intergenic
1071349489 10:84725517-84725539 CATTCATAATCACCAAAACCAGG - Intergenic
1071585089 10:86812439-86812461 TATTCATCATCGCCAAAAACTGG - Intronic
1071586966 10:86832836-86832858 TGTTCATAATAACCAAAAACTGG - Intronic
1071824715 10:89313614-89313636 TATTCATGATGGCCAAAAAGTGG + Intronic
1072075481 10:91968464-91968486 TATTCATAATTGCCAAAAACTGG - Intronic
1072171496 10:92867157-92867179 ATTTCATGTCCACCAAGAACAGG - Intronic
1072466913 10:95672327-95672349 TATTCATAATCACTCAAAACTGG - Intronic
1072519398 10:96217240-96217262 TATTCATTACAGCCAAAAAGTGG - Intronic
1073572345 10:104591261-104591283 TATTCTTGATCACCTAAAACTGG - Intergenic
1073625657 10:105093951-105093973 TATTAATAATCACCAAAAACTGG + Intronic
1074054554 10:109910695-109910717 TATTCATGATTACCAGAACCTGG - Intronic
1074203838 10:111263708-111263730 TATTCATAACAGCCAAAAACAGG - Intergenic
1074210536 10:111329592-111329614 TATTCATTATCATAAAAAACTGG + Intergenic
1074288126 10:112117653-112117675 TATTCATAACAGCCAAAAAGTGG - Intergenic
1074548557 10:114421800-114421822 TATTCGTAATCACCAAAAACTGG - Intergenic
1074660021 10:115644030-115644052 TATTCATAAACACCAAAACCTGG + Intronic
1074802372 10:117013831-117013853 TATTAATAATCACCAATAACTGG + Intronic
1075061237 10:119258351-119258373 TATTCATAATCACCAAAAATTGG - Intronic
1075061447 10:119259873-119259895 TATTCATAATCGCCAAAAACTGG - Intronic
1075361828 10:121844653-121844675 TATTGATAACCACACAAAACTGG + Intronic
1075395165 10:122121796-122121818 GAATCGTGACCACCAACAACAGG - Intronic
1075743613 10:124711028-124711050 TATTCATAACAGCCAAAACCAGG + Intronic
1076284838 10:129284554-129284576 TATTTGTGATCACCAAACACTGG + Intergenic
1076537022 10:131185925-131185947 TATTCATAATCACCAAAATGTGG + Intronic
1077260358 11:1615473-1615495 TATTCATGATCACCAAATGCTGG + Intergenic
1078193889 11:9118674-9118696 TATTCATAATAACCAAAGACTGG + Intronic
1078499691 11:11858817-11858839 TATTCAGAATCACCAAAAACTGG - Intronic
1078890362 11:15550584-15550606 TATTCATAATCAACAAAAGCTGG - Intergenic
1079516836 11:21279785-21279807 TATTCATAACCACCCAAACTTGG + Intronic
1080115094 11:28613031-28613053 TATTCATGAAAGCCAAAAACTGG - Intergenic
1080184678 11:29467604-29467626 TATTTATAATCACCAAAAATTGG + Intergenic
1080598608 11:33800473-33800495 TATTCATAATAACCAAAAAGTGG + Intergenic
1081547536 11:44082349-44082371 TATTCATAATCACCCATAACTGG + Intronic
1081670678 11:44940677-44940699 TATTCATAATCATCAACAACTGG - Exonic
1081954946 11:47083375-47083397 TATTCATGATAGCCAAAAAGTGG - Intronic
1083021754 11:59515002-59515024 TTGTCATGTACACCAAAAACAGG - Exonic
1083126408 11:60571443-60571465 TATTCATGATAGCCAAAAAATGG + Intergenic
1083979548 11:66155790-66155812 TATTCATGACGGCCAAAGGCTGG + Intronic
1084912000 11:72397296-72397318 TATTCATGACCACCAAAAACTGG - Intronic
1085106669 11:73849676-73849698 TATTCATAATTGCCAAAAACTGG - Intronic
1085342000 11:75738098-75738120 TATTCATAATCACCAAAAACTGG + Intergenic
1085649640 11:78256131-78256153 TATTCATGAGAGCCAAAAAATGG + Intronic
1086047347 11:82548465-82548487 TAGACATGAACTCCAAAAACAGG + Intergenic
1086191699 11:84087079-84087101 TATGCATAACAGCCAAAAACTGG - Intronic
1086740177 11:90357914-90357936 TATTCATAATCACTAAAAACTGG + Intergenic
1088178138 11:107077436-107077458 TATTCACAACAACCACAAACTGG + Intergenic
1088465049 11:110126049-110126071 TATTCATCAGCAAGAAAAACAGG - Intronic
1088515792 11:110632108-110632130 TATTCATGATAGCTAAAAACTGG - Intronic
1088583889 11:111342504-111342526 TATTCATAATAGCCAAAAACTGG + Intergenic
1089074110 11:115723823-115723845 TATCCATAATCACCAAAAACTGG - Intergenic
1089761136 11:120724405-120724427 TATTCATGGTCACCAGGAACTGG - Intronic
1090813737 11:130271745-130271767 TATTCATAATAGCCAAAAACTGG - Intronic
1091477800 12:794181-794203 TATTCATAATAACCCAAAACGGG - Intronic
1092073360 12:5652020-5652042 TATTCATAATTGCCAAAAACTGG - Intronic
1092824039 12:12380543-12380565 TATTCATAACAGGCAAAAACTGG - Intronic
1093214170 12:16343742-16343764 TATTCATACTTACCAAAAACTGG - Intergenic
1093280346 12:17186811-17186833 TATTCATAATCACCTAAAACTGG - Intergenic
1093803169 12:23398690-23398712 TATTTATGACCACCTAATATAGG - Intergenic
1093836786 12:23841513-23841535 TATTCATAATAACCAAAAGCTGG + Intronic
1095443665 12:42263370-42263392 TATTCATAATCGCCAAAAACTGG - Intronic
1096437215 12:51603459-51603481 TATTCATAATCACCAGAAACTGG - Intronic
1096909605 12:54969539-54969561 TAGTCATGATAACCAAAAAATGG + Intronic
1097576882 12:61405499-61405521 TATTTATAATCACCAAAAACTGG + Intergenic
1098411539 12:70189540-70189562 TATTCATAATTACCAGAAACTGG + Intergenic
1099558586 12:84144215-84144237 TATTCATAATAGCCAAAAACTGG - Intergenic
1100127701 12:91449585-91449607 CATTCATAATCACTAAAAACTGG + Intergenic
1100317714 12:93460825-93460847 TATTCCTGACAGCCAAAAACTGG - Intergenic
1100422624 12:94451866-94451888 TATTCATAACAGCCAAAAACTGG + Intronic
1100751626 12:97704578-97704600 TATTTATAATTACCAAAAACTGG + Intergenic
1100915518 12:99416277-99416299 TATTCATAACAGCTAAAAACTGG - Intronic
1101075484 12:101125269-101125291 TATTCCTAACCACTAACAACAGG - Intronic
1101086451 12:101241252-101241274 GATTCATGACCCACACAAACTGG - Intergenic
1101246960 12:102892505-102892527 TATTCATAATCATCAAAAATTGG + Intronic
1101382904 12:104229937-104229959 TATTCATAACAGCCAAAAAGTGG - Intronic
1101479355 12:105082623-105082645 TATTCATAATTGCCAAAAACTGG - Intronic
1101566982 12:105916310-105916332 TAATTATAATCACCAAAAACTGG + Intergenic
1101933181 12:109032357-109032379 TATTCATAACAGCCAAAAATTGG + Intronic
1101964416 12:109272714-109272736 TATTCACAACCACCAAAAGGTGG - Intergenic
1105632459 13:22184128-22184150 TATTCATAATTACCCAAAACTGG - Intergenic
1106007788 13:25787480-25787502 TATTCATAATCACCAAAATTAGG - Intronic
1106206612 13:27602622-27602644 TGTTGATAATCACCAAAAACTGG - Intronic
1106263452 13:28089426-28089448 TATTCATCATTGCCAAAAACTGG + Intronic
1106959290 13:34978887-34978909 TATTCATAATGGCCAAAAACTGG - Intronic
1107402233 13:40080797-40080819 TATTTATAATCACCAAAAAATGG + Intergenic
1107452853 13:40527190-40527212 TATTCATAATCACCATAAACGGG + Intergenic
1107517053 13:41139777-41139799 TATTCATGATAGCCAGAAACTGG + Intergenic
1107980971 13:45733955-45733977 AATTCATCCCTACCAAAAACTGG - Intergenic
1108199592 13:48029788-48029810 TATTCATAATCATCAAAATCTGG - Intergenic
1108579241 13:51814771-51814793 TACTCATGCCTACCAGAAACTGG + Intergenic
1108925695 13:55740893-55740915 TACTCATAACCATCACAAACTGG - Intergenic
1109233386 13:59786349-59786371 TATTCATGACATCCAAGAATAGG - Intronic
1109286773 13:60418976-60418998 TATTCATAATAACCAAAAACTGG - Intronic
1109406968 13:61913548-61913570 TGTTCATAATCACTAAAAACTGG - Intergenic
1109471164 13:62806105-62806127 TATTCATAATCACCAAGAACTGG + Intergenic
1109557240 13:63994283-63994305 TATTTATAATCACCTAAAACTGG - Intergenic
1109598356 13:64588585-64588607 TATTCATAATCACCAAAAGAGGG + Intergenic
1110003451 13:70235186-70235208 TATTCTTGACCAACAAATAATGG - Intergenic
1110157600 13:72337220-72337242 TATTCATAATCTCCAAAAATGGG + Intergenic
1110902957 13:80846533-80846555 TATTCATAAGCACCATAATCTGG - Intergenic
1110973396 13:81796630-81796652 TATTCAAAATCACAAAAAACTGG - Intergenic
1111013826 13:82349709-82349731 TATTCATAATCATCAAAAACTGG - Intergenic
1111282420 13:86044279-86044301 TATTCATGAAATGCAAAAACTGG - Intergenic
1111867213 13:93784205-93784227 TATTCATGACCAAGACAGACAGG + Intronic
1112260314 13:97872135-97872157 TATTCATAATTGCCAAAAACTGG + Intergenic
1113210032 13:107967179-107967201 TATTCATAATCACTAAAAAGTGG + Intergenic
1113314740 13:109166737-109166759 TATTCATAATCACATAAAACTGG + Intronic
1114362819 14:21994216-21994238 TATTCATAATTGCCAAAAACTGG + Intergenic
1114722914 14:24901584-24901606 TATTCATAATAACCCAAAACTGG + Intronic
1114868508 14:26627834-26627856 TATTCATAATTACCAAAAACTGG + Intergenic
1114924126 14:27371950-27371972 TATTGATAACCAAGAAAAACAGG + Intergenic
1114924292 14:27375407-27375429 TATTCATGAGAATCAGAAACTGG + Intergenic
1115161045 14:30394518-30394540 TACTCATGTCCCCCAAAAGCTGG + Intergenic
1115758193 14:36550703-36550725 TCATCATGACCAACAAAATCAGG - Intergenic
1115883198 14:37943844-37943866 TATTTATAATCACCAAAATCTGG - Intronic
1116107621 14:40530841-40530863 TATTCATAATCACTAAAGACTGG - Intergenic
1116291103 14:43041626-43041648 TATTTATAACAACCAAAAATTGG - Intergenic
1116491760 14:45511920-45511942 TATTTATAACCACAAAAATCTGG - Intergenic
1117155915 14:52941039-52941061 TATTCATCATCTCCTAAAACTGG + Intronic
1117217234 14:53564003-53564025 TATTCAAAATCACCAAAAACTGG + Intergenic
1117381275 14:55166115-55166137 TATTCATAATCACCAAAAAGTGG + Intronic
1117947915 14:61049906-61049928 TATTGCTGACCACCACACACTGG + Intronic
1118014715 14:61648028-61648050 TATTCATAATGACCAAAAACTGG + Intronic
1118266341 14:64298018-64298040 CATTCATCACCACCAAAAAAAGG - Intronic
1118368086 14:65112802-65112824 TATTCAGGACCACCAAGTATGGG + Intergenic
1118891324 14:69911776-69911798 TATTCATAATTGCCAAAAACTGG - Intronic
1119011978 14:71002780-71002802 TATTCACAACAGCCAAAAACGGG - Intronic
1119150290 14:72353294-72353316 TATTCATCATCTCCAAAGACTGG + Intronic
1119176536 14:72572362-72572384 TATTCATAATAACCAAAAAATGG + Intergenic
1119209429 14:72819416-72819438 TATTCATAATAGCCAAAAACTGG + Intronic
1119795904 14:77397114-77397136 TATTCATAATAGCCAAAAACTGG + Intronic
1120296869 14:82652530-82652552 CATTCATAATCACAAAAAACTGG - Intergenic
1120542807 14:85770760-85770782 TATTCATAATAGCCAAAAACTGG - Intergenic
1120580579 14:86243032-86243054 TATTTATTATCACCAAACACTGG + Intergenic
1120752524 14:88211072-88211094 TATTCATAACAACCAAAAAGTGG + Intronic
1121234446 14:92381898-92381920 CATACATGACCGCCTAAAACAGG - Intronic
1121244941 14:92455327-92455349 TCTTCATAACAACCAAAAAGGGG + Intronic
1121366385 14:93315847-93315869 TATTCATAATAACCAAAAAGTGG - Intronic
1121565500 14:94906552-94906574 CATTCATAAGCAACAAAAACAGG + Intergenic
1121613570 14:95297782-95297804 TATTCATAATAGCCAAAAACTGG - Intronic
1122259491 14:100504649-100504671 TACTCATAACAGCCAAAAACTGG - Intronic
1122361179 14:101165956-101165978 TATTCATAATTGCCAAAAACTGG - Intergenic
1122378217 14:101282834-101282856 TATTCATAATCAACAAAAACTGG + Intergenic
1122553522 14:102563346-102563368 TATTCATAACTGCCAAAACCTGG - Intergenic
1122825650 14:104369225-104369247 GATCCCTGACCACCAGAAACTGG - Intergenic
1122833417 14:104416762-104416784 TATTTATAACAACCCAAAACTGG + Intergenic
1122957935 14:105080092-105080114 TATTTATAATCACTAAAAACTGG - Intergenic
1123001805 14:105299920-105299942 TATTCACAACCACCTGAAACTGG + Intronic
1123398959 15:19965059-19965081 CAGCTATGACCACCAAAAACAGG + Intergenic
1123485723 15:20736331-20736353 TATTCGTAATTACCAAAAACTGG + Intergenic
1123542208 15:21305376-21305398 TATTCGTAATTACCAAAAACTGG + Intergenic
1123672191 15:22670232-22670254 TATTCATGATAGCCAAAAAGTGG - Intergenic
1124122507 15:26901085-26901107 TATTCATAACTACCAAAACTCGG - Intronic
1124324241 15:28743530-28743552 TATTCATGATAGCCAAAAAGTGG - Intergenic
1124337322 15:28867150-28867172 GATTCCTGACCAGCAGAAACTGG - Intergenic
1124528123 15:30476567-30476589 TATTCATGATAGCCAAAAAGTGG - Intergenic
1124770534 15:32531137-32531159 TATTCATGATAGCCAAAAAGTGG + Intergenic
1124951086 15:34321682-34321704 TATTCATAATATCCAAAAACTGG + Intronic
1125126900 15:36234922-36234944 TATTCATAATCATCAAAGACTGG + Intergenic
1125176173 15:36824719-36824741 TATTCACGAATGCCAAAAACTGG + Intergenic
1125437166 15:39658877-39658899 TATTCATAATCGCCAAAAAGTGG + Intronic
1125990731 15:44104995-44105017 TATTCATGATAGCCAAAAAGTGG - Intronic
1126389829 15:48135347-48135369 TGTTCATGGCCACAAAAGACTGG + Exonic
1126452031 15:48818869-48818891 TGTTCATAATAACCAAAAACTGG - Intergenic
1127097884 15:55531666-55531688 TATTCATAATTACCAAAAACTGG - Intergenic
1127113670 15:55701648-55701670 TATTCATAATCATCCAAAACTGG + Intronic
1127167304 15:56258589-56258611 CATTCCTAAACACCAAAAACAGG - Intronic
1127178372 15:56386015-56386037 TATTCATAATTACCAAAACCTGG + Intronic
1127706665 15:61554087-61554109 TAGTCATAATCACCAAAAACTGG + Intergenic
1127730386 15:61796300-61796322 TATTCATAATCACCAAAATTTGG - Intergenic
1127950892 15:63805144-63805166 TATTCATAATAGCCAAAAACTGG + Intronic
1128406813 15:67350100-67350122 TATTCATAATCACCAAAAACTGG + Intronic
1128438041 15:67675165-67675187 TATTCATCATAGCCAAAAACTGG + Intronic
1128626250 15:69207669-69207691 TATTCATAATCACCAAAACCTGG - Intronic
1128781347 15:70360680-70360702 TATTCATGATAACCAAAAGTGGG + Intergenic
1128851433 15:70961467-70961489 TATTCATAATCAACAAAAACTGG + Intronic
1128961123 15:72005938-72005960 TATTCATAACTGTCAAAAACTGG + Intronic
1129554455 15:76491346-76491368 TATGCATAATCACCCAAAACTGG - Intronic
1129684708 15:77678587-77678609 TATTCATAATCTCCAAAAACTGG - Intronic
1129824126 15:78623446-78623468 TATTCATAATTGCCAAAAACTGG + Intergenic
1130180426 15:81621522-81621544 TATTCACAATCACCCAAAACTGG - Intergenic
1130628075 15:85536540-85536562 TATTCATAATCTTCAAAAACTGG + Intronic
1130666745 15:85876116-85876138 TATTCATAATCACCCCAAACTGG + Intergenic
1131383680 15:91985390-91985412 TATTCATGATAGCCACAAACTGG - Intronic
1132421142 15:101670724-101670746 TATTCATAATCACCAAGAACTGG + Intronic
1133295188 16:4748526-4748548 TGTTGATCACCAGCAAAAACTGG + Exonic
1133655001 16:7852781-7852803 TATTCATGATAGCCAAAAAGTGG - Intergenic
1133702360 16:8320815-8320837 TATTCAGGCCCTCCACAAACTGG - Intergenic
1133799192 16:9071260-9071282 TATGCATAATCACCAAAAACTGG - Intergenic
1133870773 16:9683769-9683791 TATTCATAACAACCAAAAAGTGG + Intergenic
1134081940 16:11330899-11330921 TATTCATCATCACCCCAAACTGG - Intronic
1134334485 16:13285040-13285062 TATCCATGAATACCAAAAACCGG - Intergenic
1135475900 16:22774640-22774662 TAGTCATCACCACCAGAAGCTGG + Intergenic
1135596806 16:23750802-23750824 TATTCATAACAGCCAAAAATTGG - Intergenic
1136667601 16:31826237-31826259 TCTTCATAACAACCAACAACAGG + Intergenic
1137504273 16:49038185-49038207 TATTCATAATAACCAAAAAATGG - Intergenic
1137634893 16:49977551-49977573 TATTCATAATCATCCAAAACTGG + Intergenic
1137656725 16:50165846-50165868 TATTCATAACAGCCAAAAAATGG - Intronic
1137740707 16:50770075-50770097 TATTCATAATAGCCAAAAACTGG - Intronic
1138013822 16:53411584-53411606 TATTCATATTCACCCAAAACTGG + Intergenic
1138059703 16:53877260-53877282 TGTTCATAATCACCAAAAAGTGG + Intronic
1138064803 16:53929465-53929487 TCTTCATAATCACCAAAAACTGG - Intronic
1138356075 16:56381419-56381441 TATTCATAACTGCCAAAACCTGG + Intronic
1138379965 16:56593179-56593201 TATTTATAATCACCAAAAAGTGG + Intergenic
1138791905 16:59914811-59914833 TATTGACTATCACCAAAAACTGG + Intergenic
1139316653 16:66077130-66077152 TATTCACAACAACCAAAAACTGG + Intergenic
1139316866 16:66079858-66079880 TATTCATAATAGCCAAAAACTGG + Intergenic
1139796832 16:69489792-69489814 TATTTATTAACACAAAAAACTGG + Intergenic
1139832156 16:69808797-69808819 TGTTCATGATGGCCAAAAACTGG - Intronic
1140452862 16:75085454-75085476 TATTCCTAACAAGCAAAAACTGG - Intronic
1140464690 16:75171667-75171689 TATAAATGGCAACCAAAAACTGG + Exonic
1141014356 16:80434568-80434590 CATGCATAATCACCAAAAACTGG + Intergenic
1141122985 16:81376283-81376305 TATTCATAACAGCCAAAAACTGG + Intronic
1141166294 16:81663205-81663227 TATTCATGACTACCAGAACGTGG + Intronic
1141237942 16:82237356-82237378 TATTTATAACCACCAATAACTGG + Intergenic
1141254981 16:82392638-82392660 TATTTATAACCTCCAAAAACCGG - Intergenic
1142327231 16:89423700-89423722 TATTCATAAGCACCAGAAACTGG + Intronic
1142547890 17:717776-717798 TATTCATAATTGCCAAAAACTGG - Intronic
1143343132 17:6229675-6229697 TATGCATAACAGCCAAAAACTGG + Intergenic
1144231980 17:13216503-13216525 TATTCATCATCACCACAAAATGG + Intergenic
1144535483 17:16085442-16085464 TATTCATAGCTGCCAAAAACTGG + Intronic
1145015448 17:19393859-19393881 TATTCATAATCACCCAAACCTGG - Intergenic
1145201047 17:20944928-20944950 TCTTCATGAGAACCAAAAATCGG - Intergenic
1146036236 17:29409246-29409268 TATTCATAATAGCCAAAAACTGG - Intronic
1146101068 17:29982666-29982688 CTTTCTTGACCACTAAAAACTGG - Intronic
1146459051 17:33029556-33029578 TTTTCATGATTACCAAAAACTGG - Intronic
1146671855 17:34743385-34743407 TATTCATAATCACCAAAACCTGG - Intergenic
1146909650 17:36640610-36640632 TATTCATGATAGCCAAAAAGTGG - Intergenic
1146960485 17:36971645-36971667 TATTTATAATCACCAAAAACTGG + Intronic
1148199273 17:45739177-45739199 CATTTATAATCACCAAAAACAGG - Intergenic
1149255971 17:54827034-54827056 TATTCATAATTACCAAAAACTGG + Intergenic
1150174423 17:63035629-63035651 TATTCATAATCACCTAAAATTGG - Intronic
1150526470 17:65928486-65928508 TATTCATAACATCCAAAAAGAGG + Intronic
1151485845 17:74399215-74399237 TATTCATAATCACCAAAAACTGG - Intergenic
1151847812 17:76669953-76669975 TATTCATGATAGCCAAAAAGCGG - Intergenic
1152533482 17:80936417-80936439 TATTCATAGTCACCAAAAACTGG + Intronic
1152872247 17:82762040-82762062 TATTAATAACAGCCAAAAACCGG - Intronic
1153118844 18:1695278-1695300 TATTCATAATTGCCAAAAACTGG - Intergenic
1153177259 18:2391358-2391380 TATTCATAATAGCCAAAAACTGG + Intergenic
1153376869 18:4390769-4390791 TATTCATAACTGCCAAAAACTGG - Intronic
1153755911 18:8282798-8282820 TATTTGTGATCACCAAAAACTGG + Intronic
1153928004 18:9851644-9851666 TATTCATGACAGCAGAAAACAGG + Intronic
1154947455 18:21176317-21176339 TATTCATAACCAACAATGACTGG + Intergenic
1155414669 18:25584169-25584191 TATTCATAACCATTAAGAACTGG - Intergenic
1155907927 18:31475026-31475048 AATTAATGACCCCCAAAAAAGGG + Intronic
1156328525 18:36097168-36097190 TATTCACAATCACCAGAAACTGG - Intergenic
1156400825 18:36738250-36738272 TATTCATAACTGCCAAAAACTGG - Intronic
1156594458 18:38531845-38531867 TGTACATGATCACCAAAAACTGG - Intergenic
1156639974 18:39081642-39081664 CATTTATAATCACCAAAAACGGG + Intergenic
1157474565 18:48012992-48013014 TATTCATAATCGCCAAAAACTGG - Intergenic
1157657617 18:49406910-49406932 TATTCATTACAGCCAAAAAGTGG + Intronic
1157759221 18:50247525-50247547 TATTCATGATAGCCAAAAAGTGG + Intronic
1157956712 18:52106675-52106697 CATTCAAAATCACCAAAAACTGG + Intergenic
1158027631 18:52920745-52920767 TGTTTATAATCACCAAAAACTGG + Intronic
1158370840 18:56801874-56801896 CATTCATGATCATCAAAATCTGG - Intronic
1158433396 18:57414049-57414071 TATTCATAAGAGCCAAAAACTGG + Intergenic
1158800883 18:60907296-60907318 TATTTATATTCACCAAAAACTGG + Intergenic
1159299034 18:66538554-66538576 TATACATGATCTCCAATAACTGG - Intronic
1159568755 18:70087809-70087831 TATTCATGCACAGGAAAAACTGG - Intronic
1160570499 18:79814314-79814336 TATTACTAACAACCAAAAACTGG + Intergenic
1161223361 19:3129897-3129919 TGTTCATGATCACCTCAAACTGG + Intergenic
1161743309 19:6039036-6039058 TATTCATAATCACCCCAAACTGG + Intronic
1163854918 19:19693913-19693935 TATTCATGACAGCCAAAAGGTGG - Intergenic
1164560077 19:29285328-29285350 CATTCATAATCACCAAAAAGTGG + Intergenic
1164619364 19:29685119-29685141 TATTCATAACAACCCCAAACTGG - Intergenic
1164795881 19:31029006-31029028 TATTCACAATCACCAAAAACTGG + Intergenic
1164893841 19:31851440-31851462 TACTCATAATTACCAAAAACTGG + Intergenic
1164936085 19:32214988-32215010 TATTCACGATAGCCAAAAACTGG + Intergenic
1165165964 19:33856686-33856708 TACTCATAAAAACCAAAAACTGG + Intergenic
1165200809 19:34142948-34142970 TATTCATAATAGCCAAAAACTGG + Intergenic
1166403726 19:42503914-42503936 TATTCATAATAGCCAAAAACTGG - Intergenic
924975339 2:168790-168812 TATTCAGGATTACCAGAAACTGG + Intergenic
925212073 2:2057864-2057886 TATTCATGGTAGCCAAAAACTGG - Intronic
926086739 2:10025036-10025058 TATTCCTAAACATCAAAAACTGG + Intergenic
926287086 2:11497395-11497417 TATTCATAAGAGCCAAAAACTGG - Intergenic
926996954 2:18745956-18745978 TATTCATAACTGCCAAAAACTGG - Intergenic
927222855 2:20730236-20730258 TATTCATAATAGCCAAAAACTGG - Intronic
927903044 2:26836392-26836414 TATTCAGAATCCCCAAAAACTGG + Intergenic
928301238 2:30127129-30127151 TATTCATAAGAGCCAAAAACTGG + Intergenic
928348435 2:30522120-30522142 TATTCATAATTACCAAAAACTGG - Intronic
928501466 2:31900980-31901002 TATTCATAATAGCCAAAAACTGG + Intronic
928972414 2:37044531-37044553 TATTTATGAGAGCCAAAAACTGG - Intronic
929059447 2:37908320-37908342 TATTCATGAGAACCAAAAAGTGG + Intergenic
929323735 2:40579741-40579763 TATTCATAACAGCCAAAAAGTGG - Intronic
929616105 2:43309403-43309425 TATTCACGATCTCCAAAAAGTGG + Intronic
929706490 2:44217707-44217729 TATTCATAAAAAGCAAAAACTGG - Intronic
929855428 2:45634642-45634664 TATTCATAATCAACCAAAACTGG + Intergenic
930212307 2:48653626-48653648 TATTCACAAATACCAAAAACTGG - Intronic
930242561 2:48951581-48951603 TATTCATAAAAACCAAAAACTGG - Intergenic
930251254 2:49036276-49036298 AATTTATTACCACCAAAAAAAGG + Intronic
930757951 2:54997565-54997587 TATTCATGATAGCCAAAAAGAGG + Intronic
930792769 2:55351788-55351810 TATTCATAATAGCCAAAAACTGG + Intronic
931031593 2:58181117-58181139 CATTCATAAGCACCAAAAACTGG + Intronic
931227628 2:60347273-60347295 TATTCATGATAGTCAAAAACTGG + Intergenic
931284685 2:60821927-60821949 TATTCATAATAACCACAAACTGG + Intergenic
931593100 2:63908134-63908156 TCTTCATAACAGCCAAAAACTGG + Intronic
932002554 2:67897947-67897969 CATTAATGACCACCTAAAATAGG - Intergenic
932630456 2:73338300-73338322 TATTCATGATAACTAAAAAGTGG + Intergenic
932829567 2:74976057-74976079 TATTCATAATCACTAAAAACTGG - Intergenic
933011327 2:77067887-77067909 TCTTGATGACCATCAAAAAAAGG + Intronic
933679385 2:85086081-85086103 TATTCATGAGTGCCAAAACCTGG - Intergenic
933982560 2:87564707-87564729 TATTCATAACCACCAATATCTGG + Intergenic
934070673 2:88381090-88381112 TATTCATAATAGCCAAAAACTGG + Intergenic
934607706 2:95709968-95709990 TATTCATAATCACCAAAAACTGG - Intergenic
934858848 2:97747283-97747305 TATTCATAACAGCCAAAAAGTGG + Intergenic
934876708 2:97928131-97928153 TATTCATAATCACCAAAATCTGG + Intronic
935283889 2:101546344-101546366 TTTCCATGACCACTTAAAACTGG + Intergenic
935462833 2:103359208-103359230 TATTCATAATCACCAACAAATGG - Intergenic
935510645 2:103968415-103968437 TATTCATAATCACCAAAAACTGG - Intergenic
935950124 2:108321103-108321125 TATTCATAATCACCAAAAACTGG + Intergenic
935989072 2:108703316-108703338 TATTCATAATCACCAAAAACTGG + Intergenic
936052348 2:109233975-109233997 TATCAATGACTGCCAAAAACTGG - Intronic
936245551 2:110823386-110823408 TATTCATAATCACCAAAAACTGG - Intronic
936311281 2:111386085-111386107 TATTCATAACCACCAATATCTGG - Intergenic
936472514 2:112811646-112811668 TCTTCCTGGCCACCAAAAACAGG - Intergenic
936541050 2:113351848-113351870 TATTCATAATCGCCAAAAACTGG - Intergenic
937240096 2:120454667-120454689 TATTCATGATCAACAAAAACTGG + Intergenic
937394998 2:121527205-121527227 TATTCATAAAAGCCAAAAACTGG + Intronic
937529900 2:122815543-122815565 TGTTCATAATCACCAAGAACTGG - Intergenic
937819711 2:126295888-126295910 TATTTATAATCACCAAAACCTGG + Intergenic
937839504 2:126511323-126511345 TGTCCATCTCCACCAAAAACAGG - Intergenic
937978735 2:127598036-127598058 TATTCATCAAAGCCAAAAACTGG - Intronic
938154953 2:128927990-128928012 TATTCATAATCTCCAAAAACTGG - Intergenic
938545740 2:132329550-132329572 TATTCATAACGGCAAAAAACTGG + Intergenic
938787472 2:134645536-134645558 TAGTCATAACTGCCAAAAACTGG + Intronic
938840703 2:135159702-135159724 TATTCATGACAGCCAAAAAATGG + Intronic
938856765 2:135321071-135321093 TATTTATAATCACCTAAAACTGG - Intronic
939155030 2:138514621-138514643 TATTCATGACGGCCCCAAACTGG - Intronic
939164441 2:138625171-138625193 AATTCATGACTACAAAAAATTGG - Intergenic
939712687 2:145542522-145542544 TATTCATAATGACCAAAACCTGG - Intergenic
939836904 2:147140762-147140784 TATTCATAAACACGAAAAATTGG + Intergenic
940130293 2:150373602-150373624 TATTCATAATAGCCAAAAACTGG - Intergenic
940466424 2:154034187-154034209 TATTTATAATCACCAAAAATTGG + Intronic
940920379 2:159299029-159299051 TATTCATAACAGCTAAAAACTGG - Intergenic
941031231 2:160514026-160514048 TATTCATAATTGCCAAAAACTGG - Intergenic
941064217 2:160882657-160882679 CATTCACAATCACCAAAAACTGG - Intergenic
941879897 2:170470527-170470549 TATTCATAACAGCCAAAAAGTGG - Intronic
941884113 2:170511004-170511026 TATTCATAATCACCAAGAACTGG - Intronic
942114922 2:172719239-172719261 TATTCATAACCTCCAAATGCTGG - Intergenic
942982662 2:182100941-182100963 TTCTCATGACCACCAAACATGGG - Intronic
943183693 2:184577057-184577079 TATTCATAATTACCAAAAATTGG + Intergenic
943872823 2:193023626-193023648 TATTTATGATCACCCCAAACTGG - Intergenic
944044595 2:195394803-195394825 TATTCATAACCTCCAAAAACAGG + Intergenic
944044606 2:195394860-195394882 TATTCATAACCTCCAAAAACAGG + Intergenic
944341292 2:198603797-198603819 TATTCATAATCACCAAAAACTGG + Intergenic
944784344 2:203053004-203053026 TATTCATAACTTCCAAAAACTGG - Intronic
944940844 2:204624651-204624673 TATTTATGATAACCAAAAACTGG - Intronic
945262472 2:207856731-207856753 TATTCATAATCACTAAAAACTGG - Intronic
946118233 2:217483041-217483063 TTTTCATGTCCACAAAAATCAGG - Intronic
946543288 2:220709278-220709300 TATTCATGAGAAGAAAAAACAGG - Intergenic
946734168 2:222737905-222737927 TATTCATAATTACCAAAAAGTGG - Intergenic
946734480 2:222740709-222740731 TATTCATAATTACCAAAAAGTGG - Intergenic
947397892 2:229704421-229704443 TATTCATAATCACCAGACACTGG + Intronic
947869158 2:233423179-233423201 TATTCATGATCACCAAAAGCTGG - Intronic
947980685 2:234406275-234406297 TATTCATGACCGCCACCAGCTGG + Intergenic
948546391 2:238732383-238732405 TATTCATAATTGCCAAAAACTGG - Intergenic
948700823 2:239758642-239758664 TAGTCATAATCACCAAACACTGG - Intergenic
1168846530 20:948882-948904 TTCTCATAATCACCAAAAACTGG + Intergenic
1168894815 20:1316810-1316832 TGTTTGTAACCACCAAAAACTGG + Intronic
1169203138 20:3724673-3724695 TATTCATAATTGCCAAAAACTGG + Intergenic
1169560518 20:6795085-6795107 TATTCATAATAGCCAAAAACTGG - Intergenic
1169686462 20:8279222-8279244 TATTCACAATCAACAAAAACTGG + Intronic
1169740718 20:8890941-8890963 TATTCATAATAACCAAAAAATGG - Intronic
1170467249 20:16633488-16633510 TATTCATAATCACCAAAAACTGG - Intergenic
1171024700 20:21619106-21619128 TATTCTTAATCAACAAAAACTGG - Intergenic
1171498357 20:25573926-25573948 CATTCCTGACCACCAGGAACAGG - Intronic
1171535688 20:25886612-25886634 TATTCATGACAGCCAAAAGGTGG + Intergenic
1171844779 20:30260516-30260538 TATACATGACCAACAAAGATTGG + Intergenic
1172388605 20:34550863-34550885 TATTCACAATCACCAAAAGCTGG + Intronic
1172981617 20:38946831-38946853 TATTCATAACAGACAAAAACTGG - Intronic
1173642343 20:44612689-44612711 TATTCATGATGACAAAAAATTGG - Intronic
1174196939 20:48779571-48779593 TATTAAAAATCACCAAAAACTGG + Intronic
1175410786 20:58766934-58766956 TATTCATAATCACCAAAAACTGG - Intergenic
1176523498 21:7846460-7846482 TATTCATAATTGCCAAAAACTGG + Intergenic
1176745637 21:10649793-10649815 CAGCTATGACCACCAAAAACAGG + Intergenic
1177408522 21:20700872-20700894 TATTTATGATCACCCAACACTGG + Intergenic
1177846739 21:26297905-26297927 TAGTGATAATCACCAAAAACTGG - Intergenic
1177924474 21:27196902-27196924 TATTCATAATTGCCAAAAACTGG + Intergenic
1178657518 21:34476472-34476494 TATTCATAATTGCCAAAAACTGG + Intergenic
1179203210 21:39246576-39246598 TATTCATAACAGCCAAAAAGTGG + Intronic
1179772900 21:43636980-43637002 TATTCATAACAGTCAAAAACTGG + Intronic
1180116750 21:45712172-45712194 TATTCATAACCGCCAAAAACTGG - Intronic
1181257633 22:21574130-21574152 TATTTATGTCCCCCAAGAACAGG - Intronic
1181301981 22:21886952-21886974 TATTCATAACCGCCCCAAACTGG - Intergenic
1183128208 22:35805692-35805714 TATTCATAACTGCCAAAATCTGG + Intronic
1184179310 22:42809326-42809348 CATTCATAATCACCAAAAACTGG + Intronic
1184888204 22:47360476-47360498 TATTTATAATCACCAAAAACTGG - Intergenic
1184969750 22:48008149-48008171 TATTTACAACCACCAAAAACTGG - Intergenic
1185169401 22:49283854-49283876 TATTCATAATCACCAAAACTCGG + Intergenic
1185293835 22:50043055-50043077 TATTCATGATCGTCAAAACCTGG + Intronic
949196211 3:1311941-1311963 TATTCATGATTACAAAAAATTGG - Intronic
949463796 3:4322951-4322973 TATTCATAACAACAAAAAAGTGG + Intronic
949603185 3:5623709-5623731 TATTCATAACCACCCAAAACTGG - Intergenic
949898236 3:8786591-8786613 TATTCATTATAACCAAAAAGTGG - Intronic
949992446 3:9590957-9590979 TATTCATGATAGCCAAAAAGTGG + Intergenic
950226449 3:11238940-11238962 TATTCATAACCACCAAAAAGTGG - Intronic
950298864 3:11856633-11856655 TATTCATAACCACCAAAAATGGG - Intergenic
950321820 3:12062802-12062824 TATTCATAATCAGCAAAAACTGG + Intronic
950611358 3:14128843-14128865 TATTCATAACAGCCAAAACCTGG + Intronic
950671426 3:14528314-14528336 TATTCAAAATCACCAAAAACTGG - Intronic
951181073 3:19659657-19659679 TATTCATGATAGTCAAAAACTGG - Intergenic
951359619 3:21709862-21709884 TCTTTATAATCACCAAAAACTGG + Intronic
951695401 3:25441048-25441070 TATTCAGAACTACCAATAACAGG + Intronic
952288667 3:31993936-31993958 TATTCATAATCATCAAAACCCGG + Intronic
952491135 3:33874033-33874055 TATTCATAAATGCCAAAAACTGG - Intergenic
952767444 3:36966787-36966809 TATTCATGACAGCCTCAAACTGG + Intergenic
953139816 3:40218191-40218213 CATTCATGATCACCAAAAACTGG + Intronic
953223241 3:40992894-40992916 TATTTATAATCATCAAAAACTGG - Intergenic
953228146 3:41039711-41039733 TATTCATAATAACCAAAAACTGG + Intergenic
953474985 3:43197672-43197694 TATTCATAATAGCCAAAAACTGG + Intergenic
953773733 3:45798229-45798251 TATTCATGACAGCCCCAAACTGG - Intergenic
954495810 3:50960122-50960144 TATTCATAATAACCAAAAAGTGG - Intronic
954818661 3:53305280-53305302 TATTCATAATTACCAAAAAACGG - Intronic
955242392 3:57189923-57189945 CATTCATAATCAGCAAAAACTGG - Intergenic
955270931 3:57498603-57498625 TATTCATAATAGCCAAAAACTGG + Intronic
955634207 3:61008192-61008214 TATTGATTACCTGCAAAAACTGG - Intronic
956133135 3:66073047-66073069 TATTCATGATAGCCAAAAAGTGG - Intergenic
956160749 3:66349624-66349646 TATTTATAATCATCAAAAACTGG - Intronic
956254409 3:67268511-67268533 TATTCATAATTGCCAAAAACTGG + Intergenic
956762199 3:72453797-72453819 TATTCATAATCACCAAAACTTGG + Intergenic
956786063 3:72643343-72643365 TATTCATGAGAGCCAAAAACCGG + Intergenic
958061209 3:88484076-88484098 TATTCGTGTCCTCCAAAAATTGG + Intergenic
958169675 3:89922895-89922917 TCTTCCTGACCAACAAAAATTGG + Intergenic
959713582 3:109409280-109409302 CCTTCATAACCACCAATAACAGG + Intergenic
959809647 3:110601340-110601362 AATTCAATAACACCAAAAACTGG + Intergenic
960374558 3:116883209-116883231 TATTCATAATAGCCAAAAACTGG + Intronic
960436973 3:117638193-117638215 TATTCATAATAATCAAAAACTGG - Intergenic
960538674 3:118841114-118841136 TCTTCATGAACTCCCAAAACTGG + Intergenic
960894330 3:122486190-122486212 TATTTGTAATCACCAAAAACTGG + Intronic
961857033 3:129882581-129882603 TATTCATGATAGCCAAAAAGTGG + Intronic
961972239 3:130981459-130981481 TATTCATAATCATCAAAAAGTGG - Intronic
962538288 3:136351223-136351245 TATTAATAACCACCAAAGATTGG - Intronic
962635642 3:137328581-137328603 TATTCAGTACCATCAAAGACAGG - Intergenic
962657221 3:137560006-137560028 TATTTATAATCACCAAAAACTGG + Intergenic
962672649 3:137725131-137725153 TATTCATGATAGCCACAAACTGG - Intergenic
962810310 3:138953945-138953967 TATTTATGATATCCAAAAACTGG - Intergenic
962824996 3:139092814-139092836 TATTCATGATAGCCAAAAAGTGG - Intronic
962999110 3:140660285-140660307 TATTCCTATGCACCAAAAACAGG + Intergenic
963092573 3:141498470-141498492 CATTCATGAACCCCCAAAACAGG - Intronic
963164999 3:142192423-142192445 TATTCATAATTGCCAAAAACTGG + Intronic
963165515 3:142198123-142198145 TATTCATAACAGCTAAAAACAGG + Intronic
963819727 3:149876375-149876397 CATTCATGCCCACAAAAAAGGGG - Intronic
964460706 3:156923597-156923619 TATTCATAAGCACCAACAAGTGG - Intronic
964865737 3:161258501-161258523 TATTCATAATCACCAACAGCTGG - Intergenic
965396776 3:168168670-168168692 TATTCCTAACAGCCAAAAACTGG - Intergenic
965954540 3:174352597-174352619 TATTCATAATCACCTGAAACTGG - Intergenic
966131645 3:176647681-176647703 TATTCACAATCACCAAAAAGTGG + Intergenic
966722321 3:183076440-183076462 TATTCATAATAACCACAAACTGG - Intronic
967125564 3:186420708-186420730 TATTCACAATCATCAAAAACTGG - Intergenic
967287259 3:187884575-187884597 TATTCATGACAGCCAAAACTTGG - Intergenic
967928077 3:194668202-194668224 TATTCGTAATCACCAAAAAGTGG - Intronic
968427346 4:532713-532735 TGTTCATGTCCACAAAACACTGG - Intronic
968713022 4:2134283-2134305 TATTCATAATCACCAAAAACTGG - Intronic
968723792 4:2229356-2229378 TATTCATAACCACAGAAAATAGG + Exonic
969168734 4:5341393-5341415 TATTCATGGATACCCAAAACAGG + Intronic
969459186 4:7319149-7319171 CATTTATAATCACCAAAAACTGG - Intronic
969710329 4:8839627-8839649 TATTCATGGTCACCAGAAACCGG + Intergenic
970212426 4:13723615-13723637 TGTTCATAATAACCAAAAACTGG - Intergenic
970269400 4:14327672-14327694 TATTCATTATCACTAAAAACTGG + Intergenic
970305869 4:14732138-14732160 TATTCATGATAACTAAAAACTGG - Intergenic
970471979 4:16387958-16387980 TATTCAAGACCATCACAAATAGG - Intergenic
970646639 4:18129220-18129242 TTTTTATGACCTCCAAAAATAGG + Intergenic
971940050 4:33202266-33202288 TATTTATCACCAACAAAGACAGG - Intergenic
972001963 4:34048857-34048879 TGTTTATGACAACCATAAACTGG + Intergenic
972072674 4:35039989-35040011 TATTCTCAACCATCAAAAACTGG - Intergenic
972074628 4:35070610-35070632 TATTCATAATCACCAAAATTTGG + Intergenic
972546866 4:40088209-40088231 TATTCATAATAACCAAAAACTGG - Intronic
972673132 4:41233202-41233224 TATTCATAACAGCCAAAAACTGG + Intergenic
972738170 4:41865572-41865594 TATTAATGATCATAAAAAACTGG + Intergenic
973049409 4:45576224-45576246 TATTTATAACCTCCAAAAACTGG + Intergenic
973171210 4:47146327-47146349 TTATCATGACTACCAAAAAGAGG - Intronic
973529749 4:51824315-51824337 TATTCCTGGGTACCAAAAACTGG + Intergenic
974008263 4:56582781-56582803 TATTCATAATAGCCAAAAACTGG + Intronic
974314015 4:60253847-60253869 TATTCAAAATCACCAAAAACAGG + Intergenic
974797778 4:66775964-66775986 TATTCATAACCAACAAAATACGG - Intergenic
974896545 4:67946796-67946818 CATTCCTGACCACCACAAAGAGG - Intronic
974926057 4:68299104-68299126 TATTCATGATAGCCAAAAACTGG + Intergenic
975167427 4:71193119-71193141 TATTCATAATGGCCAAAAACTGG - Intronic
975314000 4:72931433-72931455 TTTTCTTGACCACAAAAAAGGGG + Intergenic
975642501 4:76514220-76514242 TATTCATGATAGCCAAAAAGTGG + Intronic
975856968 4:78634727-78634749 TATTTATAACAAGCAAAAACTGG + Intergenic
976443049 4:85098655-85098677 TATTCATAAAAGCCAAAAACTGG - Intergenic
976770239 4:88644354-88644376 TATTTATAATCACTAAAAACTGG + Intronic
976828966 4:89291599-89291621 TATTCATAATCTCCAAAAATGGG - Intronic
978732771 4:112049649-112049671 TATTCATGATATCAAAAAACTGG + Intergenic
979117126 4:116839915-116839937 GATTCATAGCCACCAAAAAGAGG - Intergenic
979490760 4:121325052-121325074 AATTCATAATCACTAAAAACTGG - Intergenic
979554993 4:122035483-122035505 TATTCATGATACCCAAAAAGTGG + Intergenic
979557678 4:122068290-122068312 CATTTATGTACACCAAAAACAGG + Intergenic
979890799 4:126091256-126091278 TATTCATAATTGCCAAAAACTGG - Intergenic
980064359 4:128168044-128168066 TATTCATAATCACCAAAAACAGG - Intronic
980066677 4:128196756-128196778 TATTCATGATAGCCAAAAAGTGG + Intronic
980610290 4:135151686-135151708 TTCTAATGATCACCAAAAACAGG - Intergenic
981179749 4:141726662-141726684 TTTTCATGACTGCCAAAAACTGG + Intronic
982239382 4:153283477-153283499 TATTCATAACAGCCAAAAAGTGG - Intronic
982459266 4:155648214-155648236 TATTCATAATCACCAAAAACTGG + Intergenic
982816428 4:159891138-159891160 TATTCATAATAATCAAAAACTGG - Intergenic
982928265 4:161367481-161367503 TATTCATAACTGCCAAAAACAGG - Intergenic
983119433 4:163862782-163862804 TATTCATAATCACCAAAAACTGG + Intronic
983601147 4:169530080-169530102 TATTCATAATTACCAAAAATTGG + Intronic
983689229 4:170447947-170447969 TATTCATAACAACCAAAAATTGG - Intergenic
984414773 4:179444277-179444299 TATTCATTACCATCGAAAAAAGG + Intergenic
984569081 4:181369002-181369024 TATTCATAATAGCCAAAAACTGG - Intergenic
984861698 4:184246158-184246180 AAATCATCACCACCAAAAAGGGG + Intergenic
985036541 4:185846116-185846138 TATTCATGGTCACTAAAACCTGG + Intronic
986023478 5:3826790-3826812 TATTCAAGTCCACTAAAAGCTGG + Intergenic
986527893 5:8700468-8700490 TATTCATGACCATCACATGCTGG + Intergenic
986621256 5:9677889-9677911 TATTCATAATCACTAAAAAATGG + Intronic
986991827 5:13562990-13563012 TATTAATGATCACCAAAAACTGG + Intergenic
986994896 5:13596060-13596082 TATTTTTGAGCACGAAAAACAGG - Intergenic
987039734 5:14051036-14051058 TACTCATAATAACCAAAAACTGG + Intergenic
987153667 5:15066033-15066055 TATTCATAATTGCCAAAAACTGG - Intergenic
988427705 5:31082778-31082800 TATTAATGCTCACCAAATACTGG + Intergenic
988632031 5:32941839-32941861 TATTCATGATGGCCAAAAAATGG + Intergenic
988685369 5:33520423-33520445 TATTCAAAATCATCAAAAACTGG - Intergenic
988970575 5:36463570-36463592 TATTCATAATCATCCAAAACTGG + Intergenic
989179750 5:38564591-38564613 TATTCAAAACCACCAACAGCCGG + Intronic
989642434 5:43596017-43596039 TATTCATAAGAGCCAAAAACTGG - Intergenic
990050876 5:51498445-51498467 TATTCATGTTTAACAAAAACTGG - Intergenic
990338488 5:54799283-54799305 TATTCATAATAACCAAAAAATGG + Intergenic
990463910 5:56054323-56054345 TATTCATAATCACCCAAACCTGG - Intergenic
990559819 5:56972794-56972816 TATTCATAGTCACCAAAAAGTGG + Intergenic
991382656 5:66047396-66047418 TATTCATTACAGCCAAAAAGTGG - Intronic
992094648 5:73351544-73351566 TATTCATAACAGCCAAAAAGAGG + Intergenic
992134069 5:73724818-73724840 TATTTGTAATCACCAAAAACTGG - Intronic
992240899 5:74768186-74768208 TATTCGTAATCACCCAAAACTGG + Intronic
992385114 5:76277311-76277333 TATTCATAATCACCCAAAACTGG + Intronic
992813954 5:80417744-80417766 TATTCATAACTGCCAAAAACTGG - Intronic
992874677 5:81042109-81042131 TATTCATAATCACCAAAAACTGG - Intronic
992983287 5:82200059-82200081 TATTCTTAATCACCAAAAACTGG - Intronic
993020037 5:82581023-82581045 TATTCCTATACACCAAAAACAGG - Intergenic
993196203 5:84749854-84749876 TATCAATGAACTCCAAAAACAGG - Intergenic
993460483 5:88175774-88175796 TATTCATAATCACCAAAAACTGG - Intergenic
993896554 5:93542162-93542184 TACTCATGAAGAACAAAAACTGG + Intergenic
994684186 5:102928890-102928912 TATTCATGCACATGAAAAACTGG + Intronic
996029781 5:118692495-118692517 TCTTCATTACCACCCATAACTGG + Intergenic
996809462 5:127499709-127499731 TATTCATAATAACCAAAAAGCGG + Intergenic
997313075 5:132906326-132906348 TATTCATAACAGCCAAAAAGTGG + Intronic
997448667 5:133963829-133963851 TATTCATAATAGCCAAAAACTGG + Intronic
997785724 5:136711111-136711133 TATTCATAATCACAAAAAACTGG + Intergenic
998044840 5:138978462-138978484 TATTCATAACAGCCAAAAAGTGG - Intronic
998206983 5:140164859-140164881 TATTCATAATAACCAAAAACTGG + Intergenic
998326575 5:141286067-141286089 TATTCATAACAGCTAAAAACTGG - Intergenic
998356788 5:141544965-141544987 TATTCATAATTGCCAAAAACTGG + Intronic
998550472 5:143072471-143072493 TATTCATGATAACCAAAATATGG + Intronic
998858374 5:146418259-146418281 TATTCATAATCACTAAAAACTGG + Intergenic
998962242 5:147501038-147501060 TATTCATAACCAACAAATCCTGG + Intronic
999788045 5:154910189-154910211 TATCTGTGATCACCAAAAACTGG - Intronic
999903533 5:156113728-156113750 TATTCATAATTACCCAAAACTGG + Intronic
1000200754 5:159008301-159008323 TATTTATAACCATGAAAAACTGG + Intronic
1000473313 5:161673559-161673581 TATTCATAATCACTAAAAATTGG + Intronic
1000591255 5:163160383-163160405 TATTCATGATCTCCAATAATGGG + Intergenic
1002069279 5:176669716-176669738 TGTTCATGATCACCAAAAACTGG - Intergenic
1002372343 5:178765315-178765337 TATTCACAACCACCAAAAGGTGG - Intergenic
1002464155 5:179397134-179397156 TATTCATAATAGCCAAAAACTGG + Intergenic
1002661648 5:180794896-180794918 TATTCATAATCACTCAAAACTGG + Intronic
1002695231 5:181083873-181083895 TATTCATAATTGCCAAAAACTGG + Intergenic
1003400444 6:5786293-5786315 TATTCACAATCACCAAAAGCTGG + Intergenic
1004227597 6:13800898-13800920 TATTCAAAATAACCAAAAACTGG + Intronic
1004792719 6:19045164-19045186 TATTCATGATTACCAAAACTTGG - Intergenic
1005233268 6:23729732-23729754 TATTCATAATTACCAAAAACAGG + Intergenic
1005797746 6:29385589-29385611 TATTCATAACAACCCAAAACTGG + Intronic
1006451221 6:34106829-34106851 TATTAATGACAACTACAAACAGG + Intronic
1006618084 6:35343081-35343103 GATTCAGGAACACCAGAAACGGG - Intronic
1006866058 6:37209905-37209927 TCTTCCTGACCTCCAAACACCGG - Intergenic
1006884025 6:37365080-37365102 TATTAATATTCACCAAAAACTGG + Intronic
1007065635 6:38987822-38987844 TATTGATGACCATCTGAAACAGG - Intronic
1007544451 6:42681816-42681838 TATTCATGATAGCCAAAAAATGG + Intronic
1008084990 6:47235095-47235117 TATGCATGAGTACTAAAAACGGG + Intronic
1008564957 6:52758446-52758468 TATTCATGTCCATCACCAACCGG - Intronic
1008569280 6:52799764-52799786 TATTCATGTCCATCACCAACCGG - Intronic
1009339548 6:62536868-62536890 TAGTCATGACCACTAAACTCTGG + Intergenic
1009843854 6:69111410-69111432 TATTCATGGCCACAAAAAGGGGG - Intronic
1010587996 6:77678316-77678338 AATTCATGACAGTCAAAAACTGG - Intergenic
1010719575 6:79267577-79267599 TATTCATAATAACCAAAAAGTGG + Intergenic
1010782843 6:79965316-79965338 TCTTCATAATCACCAAAAATTGG + Intergenic
1011096405 6:83669918-83669940 TATTTGTAATCACCAAAAACTGG - Intronic
1011529602 6:88306277-88306299 TATTCATAATCACCAAAAACTGG - Intergenic
1011561724 6:88625297-88625319 TATTTGTGACCATCCAAAACTGG + Intronic
1011573761 6:88770571-88770593 CATTCATGATAGCCAAAAACTGG - Intronic
1011868923 6:91868017-91868039 TATTCATAACAACTCAAAACTGG - Intergenic
1012143611 6:95653773-95653795 TATTCCTAACCACTCAAAACTGG + Intergenic
1012175548 6:96077832-96077854 TATTCTTAACCACAAAACACTGG - Intronic
1012312651 6:97746879-97746901 TATTCATAATTACCAAAACCTGG - Intergenic
1012367922 6:98464854-98464876 TATTCAGGATCACCAGAAAGGGG + Intergenic
1012445277 6:99301066-99301088 TGTACATAATCACCAAAAACTGG + Intronic
1012793282 6:103727791-103727813 TATTCATAACAGCCAAAAACTGG + Intergenic
1013453508 6:110308654-110308676 TATTCATAAACACCAAAAAGTGG + Intronic
1013578836 6:111511964-111511986 TATTCATAACTACCAAAAACTGG + Intergenic
1013754647 6:113446569-113446591 TATTCATAATAGCCAAAAACTGG + Intergenic
1013775751 6:113676803-113676825 TATTCTTGTTCACCAAATACAGG - Intergenic
1013947700 6:115742173-115742195 TATTCATAACAACCAAAACCTGG + Intergenic
1014309053 6:119776241-119776263 TATTCATAAGAGCCAAAAACTGG - Intergenic
1014659357 6:124148742-124148764 TATTCATGATGGCCAAAAATTGG - Intronic
1014691347 6:124567282-124567304 AATTCATGATCACCAATAATTGG + Intronic
1014801585 6:125784606-125784628 TATTCATAATAGCCAAAAACTGG + Intronic
1015056797 6:128912065-128912087 TATTCATGATAATTAAAAACTGG - Intronic
1015728469 6:136323893-136323915 TATTCAAGTCCACAGAAAACAGG - Intergenic
1015771066 6:136769067-136769089 TATTCATGACAGTCAAAAAGTGG + Intronic
1015818672 6:137237002-137237024 TATTCATAATCACCAACAACTGG - Intergenic
1015855567 6:137621101-137621123 TATCTATAATCACCAAAAACTGG + Intergenic
1016589196 6:145725492-145725514 TATTCATAATCACCCAAACCTGG + Intronic
1016834476 6:148463567-148463589 TCTTTATGACCACTAAAAATCGG + Intronic
1017149967 6:151270456-151270478 TATTCATGACAGCCAAAAGGTGG - Intronic
1018550010 6:164985091-164985113 TATTCATAATCACCAAAAACTGG - Intergenic
1018550015 6:164985175-164985197 TAATCATAATCACCAAAAACTGG - Intergenic
1018675465 6:166218226-166218248 TATTCATAATTGCCAAAAACTGG + Intergenic
1019093180 6:169557113-169557135 TATTTGTAATCACCAAAAACTGG + Intronic
1019208660 6:170385697-170385719 TATTCATAACTACCAAAACTTGG + Intronic
1019860166 7:3650983-3651005 TATTCATCATGGCCAAAAACTGG - Intronic
1019948795 7:4353735-4353757 TATTCATAATCACCAAAAACTGG - Intergenic
1020226474 7:6284278-6284300 TATTCGTAATAACCAAAAACAGG + Intergenic
1020597840 7:10231629-10231651 TATTCATAATAGCCAAAAACTGG - Intergenic
1020602193 7:10290148-10290170 TATTCTTGAAAACCAAAAATTGG - Intergenic
1020675837 7:11183947-11183969 TATTCATAATCACTAAAAACCGG - Intergenic
1021020315 7:15590098-15590120 TGTTTATAATCACCAAAAACTGG + Intergenic
1021139093 7:17001719-17001741 TATTCATAATCACTAGAAACTGG - Intergenic
1021271956 7:18599713-18599735 TATTCATAATCACCAAAATTTGG - Intronic
1022154425 7:27645084-27645106 TATTCATCATCACGAAAAAGTGG - Intronic
1022244581 7:28546314-28546336 TATTCATAATAACCAAAAAGTGG - Intronic
1022646628 7:32236856-32236878 TATTCATAATCACCAAAAACTGG + Intronic
1022651929 7:32285419-32285441 TATTCATAATAACCAAAAACTGG + Intronic
1022900598 7:34806236-34806258 TATTCATAATCACCAAAAACTGG + Intronic
1023096358 7:36663730-36663752 TATTCATAATCATCAAAGACTGG - Intronic
1023376687 7:39563000-39563022 TATTCATAATAGCCAAAAACTGG + Intergenic
1023384189 7:39638791-39638813 TATTCACAACAACCAAAAAGTGG - Intronic
1023587063 7:41741930-41741952 TCTCCTTGACCAACAAAAACTGG - Intergenic
1023963263 7:44945575-44945597 TATTCATAATCACCAAACACTGG + Intergenic
1024026942 7:45418924-45418946 AATTCATGACCAACATAAACTGG - Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1024581700 7:50805961-50805983 TATTCATAGCAGCCAAAAACTGG - Intergenic
1025091851 7:56070718-56070740 TATTCATGATCTCCAAAAACAGG + Intronic
1025961801 7:66229556-66229578 TAGTCATAATCACCAAAATCTGG - Intronic
1027422504 7:78030939-78030961 TATTCATAATCACCAAAAACTGG + Intronic
1027585859 7:80057806-80057828 TATTCGTAACCACCAAAAGGGGG + Intergenic
1027611265 7:80363947-80363969 TATTCATAATAGCCAAAAACTGG - Intergenic
1028482128 7:91318439-91318461 TATTCATAATAATCAAAAACTGG + Intergenic
1028701132 7:93781751-93781773 TATTCATAATTGCCAAAAACTGG + Intronic
1028724717 7:94074197-94074219 TCTTTATGACCACAAAAAATAGG + Intergenic
1028949965 7:96623677-96623699 TATGCATCACCAACAAAATCAGG - Intronic
1030175279 7:106646660-106646682 TATTCATAATCATCAGAAACTGG + Intergenic
1030243452 7:107355490-107355512 TATTCATAACTGGCAAAAACTGG + Intronic
1030257438 7:107526605-107526627 TATTCATAATCACCAAAAACTGG + Intronic
1030275630 7:107718608-107718630 TATTCATGAGAGCCCAAAACTGG - Intergenic
1030674681 7:112372030-112372052 TATTCATAATAACCAAAAAGTGG + Intergenic
1031005384 7:116464554-116464576 TATTCATCATAACCCAAAACTGG + Intronic
1031653635 7:124323751-124323773 TATTTATGACAACCAAAAGGTGG - Intergenic
1031674985 7:124598934-124598956 TATTCATTATGACCAAAAACTGG + Intergenic
1032297806 7:130658111-130658133 TGTTTATAATCACCAAAAACTGG + Intronic
1033249176 7:139744134-139744156 TATTCATAACAGCCAAAAAGTGG + Intronic
1033336564 7:140458225-140458247 TATTCATAATAGCCAAAAACTGG + Intronic
1033792299 7:144805330-144805352 TACTCGTGACACCCAAAAACTGG + Intronic
1033889267 7:145989219-145989241 TATTCATAATTGCCAAAAACTGG - Intergenic
1034112350 7:148549321-148549343 TATCCATGATCACTAAAAACTGG + Intergenic
1034817945 7:154190025-154190047 TATTCATGAACATTAAAAGCTGG + Intronic
1035757878 8:2047641-2047663 TGCTCAGGACCACCAAAATCAGG - Intronic
1036388607 8:8305118-8305140 TATTCATGACAGCCAAAGAGTGG + Intergenic
1038377214 8:27053357-27053379 TATTCATAATCACCAAAAACTGG + Intergenic
1038582075 8:28756521-28756543 TATTCATAATATCCAAAAACTGG - Intergenic
1038783595 8:30590360-30590382 TCTTCATAACCACCAACAATTGG - Intronic
1039157280 8:34575245-34575267 TGTTCATGTCCACCAAAGTCAGG + Intergenic
1039196540 8:35038408-35038430 TATTCATAATCACCAAACACAGG + Intergenic
1039205974 8:35155144-35155166 TATTCATAATTACCCAAAACTGG + Intergenic
1040004792 8:42610731-42610753 TATTCATAACTGCCAAAACCTGG + Intergenic
1040064156 8:43131132-43131154 TATTCATAATAACCCAAAACTGG - Intergenic
1040074518 8:43215525-43215547 TATTGATTATCACCAAAAAGTGG - Intergenic
1040669215 8:49667336-49667358 TATTCATAATAACCAAAACCTGG - Intergenic
1041048576 8:53910653-53910675 TATTCATAAGCACCCAAAACAGG + Intronic
1041093249 8:54324443-54324465 TGTTCATGATCACCAAAACTTGG + Intergenic
1041285713 8:56259446-56259468 TATTCATCATAACCAAAAAGTGG - Intergenic
1041367068 8:57117832-57117854 TATTCATGATAATCAAGAACTGG - Intergenic
1041400312 8:57436108-57436130 TATTCATAATAACCAAAAAGTGG - Intergenic
1042272125 8:66965301-66965323 TATTCATAATCACCAAAAACTGG - Intronic
1042451543 8:68953114-68953136 TATTCATAATTGCCAAAAACTGG + Intergenic
1042690076 8:71488016-71488038 TATTCACAACAACCAAAAAAAGG + Intronic
1042889581 8:73592878-73592900 TATTTAAAACCAGCAAAAACAGG - Intronic
1043015220 8:74931260-74931282 TATTCATAATCACCAAACACTGG - Intergenic
1043484035 8:80681141-80681163 TATTCATTATCACCCCAAACTGG - Intronic
1043684656 8:83070683-83070705 TTTGCATGACTACCAAAAGCTGG + Intergenic
1043869024 8:85409731-85409753 TATTCATAATAACCAAAAAGTGG + Intronic
1044437412 8:92180379-92180401 TATTCATAATCACTAAAAACTGG - Intergenic
1045172953 8:99690927-99690949 TATTCATCATCACCAAAAACTGG + Intronic
1045704501 8:104905327-104905349 TATTCACAACCCCCTAAAACTGG - Intronic
1045825608 8:106394498-106394520 TATTCATAATCATTAAAAACTGG + Intronic
1046246940 8:111576066-111576088 TATTCATGATATTCAAAAACTGG - Intergenic
1046428396 8:114086669-114086691 TATTCATAATAAGCAAAAACTGG - Intergenic
1046576336 8:116034614-116034636 TATTTATAATCTCCAAAAACCGG + Intergenic
1046641365 8:116735477-116735499 TATTCATAACAGCTAAAAACCGG + Intronic
1046935254 8:119879407-119879429 TATTCATAATAATCAAAAACAGG + Intronic
1047050691 8:121108667-121108689 TATTCATAATCACCAAAACTTGG + Intergenic
1047751510 8:127884393-127884415 TATTCATAACAGCCAAACACTGG - Intergenic
1048328350 8:133455509-133455531 TTTTCATGACAAACAAAAATGGG + Exonic
1048581973 8:135736427-135736449 TATTTATAACAACCAAAACCTGG - Intergenic
1048821964 8:138388459-138388481 TATTCATAACTACCAAAACTCGG + Intronic
1048920283 8:139223441-139223463 TGTTCATAATCACCAAAAACTGG + Intergenic
1049027374 8:140003913-140003935 TATTCATAATCACAAAAAGCTGG + Intronic
1049993496 9:1011862-1011884 TGTTCACAACTACCAAAAACAGG - Intergenic
1050059427 9:1690184-1690206 CGTTCATAATCACCAAAAACTGG - Intergenic
1050392846 9:5164895-5164917 TATTCATAATGACCAAAAAGTGG - Intronic
1051222339 9:14862897-14862919 TATTCATAACAGCCAAAAAATGG - Intronic
1051432115 9:16990034-16990056 TATTCATGAGAGCCAAAAACTGG - Intergenic
1051561766 9:18450090-18450112 TATTCATAATCACCAAGAACTGG + Intergenic
1051643154 9:19242342-19242364 TATTCGTAATCACCAAAACCTGG - Intronic
1052062356 9:23975966-23975988 TATTCATAACAACCCAAACCTGG + Intergenic
1052143248 9:25015450-25015472 TATTCATAATCATCCAAAACTGG + Intergenic
1052318959 9:27146674-27146696 TATTCATAATCACCCCAAACTGG - Intronic
1052529905 9:29668680-29668702 TATTTATAACAACAAAAAACTGG - Intergenic
1053026906 9:34737467-34737489 TATTCATGGTAGCCAAAAACTGG - Intergenic
1053292174 9:36888333-36888355 TATTCATGATAGCCAAAAAGTGG + Intronic
1053490138 9:38493392-38493414 TATTCCTGTACACCGAAAACAGG + Intergenic
1055746487 9:79451492-79451514 TATTCATGTTTGCCAAAAACTGG - Intergenic
1055882381 9:81016219-81016241 TATTTATACTCACCAAAAACTGG + Intergenic
1055898348 9:81206299-81206321 TATTCATAACAGCCAAAAAGTGG + Intergenic
1055916906 9:81412453-81412475 TATTCATAATCACCAACAATTGG + Intergenic
1056381266 9:86059261-86059283 TATTCATGAAGGCCAAAAAGTGG + Intronic
1056471945 9:86913973-86913995 TATTCATAATAACCAAAAAGTGG + Intergenic
1057446444 9:95118840-95118862 TATTCATGACAGCCCCAAACTGG - Intronic
1057670465 9:97082682-97082704 TATTCCTGTACACCAAAAACAGG + Intergenic
1057732815 9:97625349-97625371 TATTCATAATAACAAAAAACTGG - Intronic
1058011895 9:99987918-99987940 TGTTCATAATCACCAAAATCTGG - Intronic
1058064937 9:100538835-100538857 TATTCATGAAAACAAAAGACTGG - Intronic
1058778252 9:108307567-108307589 TATTCACAACCACCCCAAACTGG + Intergenic
1058920595 9:109610937-109610959 TCTTCCTGACCTCCAAAGACTGG - Intergenic
1059090384 9:111350850-111350872 TATTTATAAAAACCAAAAACTGG - Intergenic
1059262087 9:112987428-112987450 TATTCACAACAACCAAAAAGAGG + Intergenic
1059765602 9:117380971-117380993 TATTCACGATAACCAAAAAGTGG + Intronic
1060071745 9:120555773-120555795 TATTAATAATCACCAAAAGCTGG + Intronic
1060082724 9:120666715-120666737 TATTAATAATCACCAAAACCTGG + Intronic
1060083462 9:120675164-120675186 TATTCATAATCACCAAACATTGG + Intronic
1060900905 9:127257198-127257220 TATTGATAACAGCCAAAAACTGG - Intronic
1060955849 9:127639015-127639037 TATTCATAATAACCAAAAAGTGG - Intronic
1062159601 9:135072996-135073018 TATTCATAACAGCCAAAAAGTGG - Intergenic
1062198596 9:135288425-135288447 TATTCATTACAGCCAAAACCCGG + Intergenic
1186399939 X:9248437-9248459 TATTCACAATCACCAAAAACTGG + Intergenic
1186416694 X:9389760-9389782 TATTCATAGTCACCAAAAGCTGG - Intergenic
1186636171 X:11407422-11407444 TATTCATAACAACAAAAAAGTGG - Intronic
1186658461 X:11642504-11642526 TATTCATAATAACCAAAAAGTGG + Intronic
1186891584 X:13964241-13964263 TATTCATAATAGCCAAAAACTGG - Intergenic
1186936341 X:14453757-14453779 TATTCATAATAACCCAAAACTGG + Intergenic
1186958967 X:14714199-14714221 CATTTATGACCAGCCAAAACAGG + Intronic
1187276368 X:17819553-17819575 TATTCATGAGAACCACAAAATGG + Intronic
1187714399 X:22088249-22088271 TATTCAATATCACCCAAAACTGG - Intronic
1187727503 X:22218681-22218703 TATTTATGAACACCTAGAACAGG - Intronic
1188031557 X:25269483-25269505 TATTCATAATATCCAAAAACTGG - Intergenic
1188181597 X:27063137-27063159 TATTCACGATCACCAAAATGTGG + Intergenic
1188569499 X:31565566-31565588 TATTCATTATAGCCAAAAACTGG - Intronic
1189046446 X:37597257-37597279 TATTCATAACAGCCAATAACTGG - Intronic
1189431104 X:40948277-40948299 TTTTCATAATCACCAAGAACTGG + Intergenic
1189540628 X:41984092-41984114 TATTCATAATCACCAAAAACTGG - Intergenic
1189715830 X:43865116-43865138 TATTCATAATAACCAAAAAGTGG + Intronic
1189823172 X:44890322-44890344 TATTCACAACAGCCAAAAACCGG - Intronic
1189931851 X:46020471-46020493 TATTCATAATCGCCAAAAACTGG - Intergenic
1190028657 X:46950561-46950583 TGTTCATGAGAACCAAAAGCTGG - Intronic
1190073362 X:47297126-47297148 TATCCATAACAGCCAAAAACTGG - Intergenic
1190280792 X:48928332-48928354 TATTCATAATCATCAAAAACTGG + Intronic
1192374587 X:70546928-70546950 TATTCATGATAGCCAAAAAGTGG + Intronic
1192387613 X:70688351-70688373 TATTGATAATCACCAAACACAGG + Intronic
1192619667 X:72665789-72665811 TATTCATAATTGCCAAAAACTGG - Intronic
1192903680 X:75526175-75526197 TATTCATAACAACCAAAATTTGG - Intergenic
1193245475 X:79223665-79223687 TATTCATAACAATCAAAAGCTGG + Intergenic
1193465932 X:81847337-81847359 TATTCTTTATTACCAAAAACTGG + Intergenic
1193654224 X:84179394-84179416 TATTCATAATCACCAAACACTGG + Intronic
1193727256 X:85057135-85057157 TATTCCTAATCACCAAAAGCTGG - Intronic
1194164179 X:90494358-90494380 TATTTATAATCACCAATAACTGG - Intergenic
1194222665 X:91214905-91214927 TTTTCATGCCTACCAAACACAGG - Intergenic
1194506013 X:94734316-94734338 TATTCATACCCACCAAACATCGG - Intergenic
1194685375 X:96907846-96907868 TATTCATAATCATCAAAACCTGG + Intronic
1194864028 X:99043079-99043101 TATACATAATCACCAAAACCTGG - Intergenic
1195488139 X:105434421-105434443 TATTCATAATTGCCAAAAACTGG + Intronic
1195496078 X:105535522-105535544 TATTCATAATCTCCGAAAACTGG + Intronic
1195633059 X:107080048-107080070 TATTCATAATTGCCAAAAACCGG - Intronic
1195846554 X:109235327-109235349 TATTCATAATTACCAAAAACTGG + Intergenic
1196169631 X:112573534-112573556 TATTCATAAGAGCCAAAAACTGG + Intergenic
1196402769 X:115333417-115333439 TATTCATAACAACTAAAAAGAGG - Intergenic
1196656124 X:118219174-118219196 TATTCATAACTGCTAAAAACTGG - Intergenic
1196719688 X:118841675-118841697 TATTCATAACAACCAAAAAGTGG - Intergenic
1196890891 X:120289742-120289764 TATTCATAATAACCAAAAAGTGG + Intronic
1197015119 X:121615416-121615438 TTTTCATGATCAGCAAAAACTGG - Intergenic
1197125202 X:122937969-122937991 TATTCTTAATTACCAAAAACTGG + Intergenic
1197213023 X:123843696-123843718 TTTTCATAACTGCCAAAAACAGG + Intergenic
1197876905 X:131118098-131118120 TATTCATAATAGCCAAAAACTGG - Intergenic
1198033029 X:132773798-132773820 GATTTGTGACCACCAAAAGCTGG + Intronic
1198182330 X:134221862-134221884 TATTCATAATAACCAAAAAGAGG + Intergenic
1198367553 X:135957165-135957187 TATTCATAACCAGCAAAGACTGG + Intergenic
1198457415 X:136830164-136830186 TATTCATGATAGCCAAAAAGTGG - Intergenic
1198473089 X:136967556-136967578 TATTCATAACCATCAAAAACTGG - Intergenic
1198710750 X:139500522-139500544 TATTCATAATGACCAAAAAGTGG + Intergenic
1198790906 X:140344752-140344774 TAGTCATTATCACCAAATACAGG - Intergenic
1199095593 X:143734958-143734980 TATTCATAATCACCAAAAACTGG + Intergenic
1199105083 X:143856563-143856585 AATTCCTGTACACCAAAAACAGG - Intergenic
1199390904 X:147277628-147277650 TATGCATAATCACCAACAACTGG + Intergenic
1199475781 X:148243543-148243565 CATTCATAATCACTAAAAACTGG + Intergenic
1199555546 X:149104281-149104303 TATTTATAATCACCAAAACCTGG - Intergenic
1199584050 X:149394441-149394463 TACTCATAATCACCCAAAACTGG + Intergenic
1199738390 X:150707790-150707812 TATTCATAATCACCGAAAACTGG + Intronic
1199808824 X:151328900-151328922 TATTCACAACAACCAAAAAGTGG + Intergenic
1199814181 X:151382962-151382984 TTTTCATGATCACTAAAATCTGG + Intergenic
1200510439 Y:4072170-4072192 TATTTATAATCACCAATAACTGG - Intergenic
1200559196 Y:4678670-4678692 TTTTCATGCCTACCAAACACAGG - Intergenic