ID: 1084916728

View in Genome Browser
Species Human (GRCh38)
Location 11:72434262-72434284
Sequence CCCGGTGGCTGCCCCACGTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084916713_1084916728 30 Left 1084916713 11:72434209-72434231 CCCCAAGTGGCAGCCGCGAGGCA 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1084916728 11:72434262-72434284 CCCGGTGGCTGCCCCACGTCCGG 0: 1
1: 0
2: 0
3: 17
4: 111
1084916715_1084916728 28 Left 1084916715 11:72434211-72434233 CCAAGTGGCAGCCGCGAGGCATT 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1084916728 11:72434262-72434284 CCCGGTGGCTGCCCCACGTCCGG 0: 1
1: 0
2: 0
3: 17
4: 111
1084916714_1084916728 29 Left 1084916714 11:72434210-72434232 CCCAAGTGGCAGCCGCGAGGCAT 0: 1
1: 0
2: 0
3: 0
4: 64
Right 1084916728 11:72434262-72434284 CCCGGTGGCTGCCCCACGTCCGG 0: 1
1: 0
2: 0
3: 17
4: 111
1084916717_1084916728 17 Left 1084916717 11:72434222-72434244 CCGCGAGGCATTTGGTATCGAAG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1084916728 11:72434262-72434284 CCCGGTGGCTGCCCCACGTCCGG 0: 1
1: 0
2: 0
3: 17
4: 111
1084916721_1084916728 -9 Left 1084916721 11:72434248-72434270 CCTCCCTGGCGCCCCCCGGTGGC 0: 1
1: 0
2: 0
3: 27
4: 223
Right 1084916728 11:72434262-72434284 CCCGGTGGCTGCCCCACGTCCGG 0: 1
1: 0
2: 0
3: 17
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084916728 Original CRISPR CCCGGTGGCTGCCCCACGTC CGG Exonic
900192480 1:1357295-1357317 CCGGGTGGCAGCCCCGCTTCCGG - Intronic
900206405 1:1433672-1433694 TCCGGTGTCTGCCTCAAGTCCGG + Intergenic
900507035 1:3034889-3034911 CCAGGTGTCTGCCCCAGGCCTGG + Intergenic
900587342 1:3439680-3439702 CCCTGTGGCTGTCCCTTGTCAGG - Intergenic
901797971 1:11691594-11691616 CCCCGGGGCTGCCCCTCGGCTGG + Exonic
902070253 1:13728522-13728544 CCCTGGGGCTGCCCAGCGTCTGG + Intronic
902301860 1:15507624-15507646 CCCGATGACTGCCCCTCATCAGG + Intronic
902658775 1:17887241-17887263 CCCTGTTCCTGCCCCACGTGGGG - Intergenic
904672931 1:32179741-32179763 TCCGATGGCTTCCCCACCTCTGG - Intronic
911297469 1:96134840-96134862 CCCGGGGGCAGCACCACATCGGG - Intergenic
914901747 1:151714839-151714861 CCAGGTGTCTGCCCCACTTCTGG - Intronic
1063377597 10:5563402-5563424 CCAAGTCGCTGCCCCAGGTCTGG + Intergenic
1067233009 10:44425218-44425240 CGCGGTGGCTTCCCTCCGTCAGG + Intergenic
1072784793 10:98272379-98272401 TCCTGTGGCTGCCCCATGCCTGG + Intergenic
1075646692 10:124101433-124101455 GCAGGTGGCTGCCCCCCATCAGG + Intergenic
1077362459 11:2146745-2146767 CCCTGTACCTGCCCCACGACAGG - Exonic
1077411983 11:2407938-2407960 CCTTGTGGCTGCCCCCGGTCTGG - Intronic
1077433547 11:2527565-2527587 GCTGGTGGCTGCCCCAGGGCGGG - Intronic
1077839668 11:5961022-5961044 CCCGGCAGCCGCCCCCCGTCTGG + Intergenic
1083477174 11:62922065-62922087 CCAGGTGCCTGCCCCATGTGCGG + Intergenic
1083620881 11:64048830-64048852 CCTGGTGCCTGGCCCACCTCGGG - Intronic
1084916728 11:72434262-72434284 CCCGGTGGCTGCCCCACGTCCGG + Exonic
1087093001 11:94294231-94294253 CCCAGTGGCTGCCACATGGCAGG + Intergenic
1088495783 11:110430185-110430207 GCCGGTGGCTGCACCACGCTGGG + Exonic
1101466766 12:104957865-104957887 CCCCGCGCCTGCCCCACCTCGGG - Intronic
1103764777 12:123272019-123272041 CCGGGCGGCTGCCCCGCGCCCGG + Exonic
1104644176 12:130485410-130485432 CCCGGCCACTGCCCCACTTCTGG + Intronic
1104941763 12:132398529-132398551 ACCGGTGGATGACCCACGCCAGG - Intergenic
1104965098 12:132505424-132505446 CCTGGGGACTGCCCCCCGTCTGG + Intronic
1106185285 13:27404488-27404510 CCCGGAGCCTGTCCCTCGTCAGG + Intergenic
1109124936 13:58505698-58505720 CCGGCTGGCTGCCCCAAGTGTGG + Intergenic
1115646082 14:35369305-35369327 CCTCGTGGCTGCCCCACGCTGGG + Intergenic
1118379998 14:65209681-65209703 CCCGCTGGCTGCCCCATCCCTGG - Intergenic
1125580587 15:40782761-40782783 CCCGGTGGCTGCCTCATGGATGG - Intronic
1129240070 15:74245726-74245748 CCCTGTGGCTGCGGCACGTGGGG + Intronic
1132514762 16:361158-361180 CCCGGTGGGTCTTCCACGTCAGG - Intergenic
1132555502 16:570209-570231 CCCGGGGGCGGCCCCACTTCTGG - Intronic
1134234005 16:12451439-12451461 TCCGGTGGCTGCCCAATGTGTGG + Intronic
1136470159 16:30474332-30474354 CTCGGGGGCTGCCCCAGGGCGGG - Intronic
1139466962 16:67159340-67159362 CCCGGGGGCAGCCCCACCTCTGG + Intronic
1141600703 16:85124381-85124403 CCCGCTGCCCGCCCCACCTCGGG + Intergenic
1141695221 16:85615920-85615942 CGCGGTGTCCGCCCCACGCCTGG - Intronic
1141820192 16:86440398-86440420 CCAGGTGGCTTCCCTAGGTCAGG - Intergenic
1146500937 17:33363875-33363897 CCAGGTGGCTGCCCCAGGAAAGG - Intronic
1146703255 17:34980659-34980681 CCCGCTGCCTTCCCCACGCCGGG - Intronic
1148155895 17:45425205-45425227 CAGGGTGGCTGCCCCACCTGGGG + Intronic
1149993078 17:61393534-61393556 CCCAGGAGCTGCCCCAGGTCTGG - Intergenic
1151351108 17:73532744-73532766 CCCGCTGCATGCCCCACCTCTGG - Intronic
1151495209 17:74454461-74454483 CCCTGTCGCTGCCTTACGTCTGG + Intergenic
1152068492 17:78124101-78124123 CCAGGGGGCTGCCACACGGCTGG + Exonic
1152784382 17:82240390-82240412 CCCGCTGGCACCCCCACATCAGG + Intronic
1158434884 18:57428517-57428539 CACGGCCGCTGCCCCACGCCGGG - Intergenic
1160706319 19:531827-531849 CCCGGTGGCTCCCCCCCGGACGG + Exonic
1162348715 19:10136217-10136239 CCTGGTGCCTGCCCCACACCGGG - Exonic
1162386737 19:10364651-10364673 CGAGGTGGCTCCCCCACGGCTGG - Exonic
1163109412 19:15150386-15150408 CCCTGTGGCTGCACCATGCCTGG + Intergenic
1164405021 19:27936793-27936815 CCCGGTGCCAGCCCCACTTGGGG - Intergenic
925060196 2:884988-885010 CCACGAGGCTGCCCCACTTCAGG - Intergenic
927256321 2:21043757-21043779 CCCTGTGGCTGCCCTCCCTCTGG + Intronic
930358249 2:50346959-50346981 CGCGGCGGCTGCCCCTCGGCGGG - Intronic
930611819 2:53553445-53553467 CCCAGAGTCTGCCCCACATCAGG + Intronic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
938070856 2:128307439-128307461 CCCGGTGCCTGCACCAGGTAGGG - Intronic
943747718 2:191479693-191479715 CCCTCTGGCTGCCCAACGTGTGG - Intergenic
947810873 2:233003247-233003269 CCTGGTGGCTGCCCCAGGTGGGG + Intronic
948632992 2:239313866-239313888 GCAGGTGGCTGCCCCAGGACAGG - Intronic
949035749 2:241815089-241815111 CCCGGGCGCTGCCCCACGAGAGG - Exonic
1172028852 20:31967975-31967997 CCCGGGGGCTGCCCCCCCTTCGG + Intergenic
1172379507 20:34476388-34476410 GCCGGTGGCTGCACCACGCCGGG - Intronic
1174051599 20:47771085-47771107 CCACGTGGCTGCCCCAGGCCTGG - Intronic
1174300121 20:49575726-49575748 CTGGGTAGCTGCCCCACCTCTGG - Intergenic
1175963437 20:62648386-62648408 CCCTGTGGCTGCCCCGCCCCAGG - Intronic
1176045934 20:63092566-63092588 TCCGGCTGCTGCCCCACGTGGGG + Intergenic
1176094884 20:63336082-63336104 CCCCGTGGCTGGCCCAGGGCTGG - Intergenic
1176120096 20:63450416-63450438 CCCTGGGGCTGCCCCAGGTGTGG + Intronic
1176548917 21:8213287-8213309 CCCGGTGGCGGCCCGGCGTCCGG + Intergenic
1176556812 21:8257500-8257522 CCCGGTGGCGGCCCGGCGTCCGG + Intergenic
1176575751 21:8440541-8440563 CCCGGTGGCGGCCCGGCGTCCGG + Intergenic
1178411420 21:32366589-32366611 CCATGTGGTTGCCCCACTTCTGG - Intronic
1179479404 21:41668183-41668205 CCTGCTGGCTGCTCCACGTCTGG - Intergenic
1180801804 22:18635400-18635422 CCCGGTGGCTGCCTGTGGTCTGG - Intergenic
1181219918 22:21359861-21359883 CCCGGTGGCTGCCTGTGGTCTGG + Intergenic
1182552450 22:31107548-31107570 CCGAGTCGCTGCGCCACGTCTGG + Intronic
1184313792 22:43666377-43666399 TCCGGTGCCTGCCCCACTGCCGG - Intronic
1184511167 22:44934141-44934163 CCTGGTGGCTGCCACAAGGCAGG + Intronic
1185008621 22:48300304-48300326 CCCAGTGGCTGCCCCAGGCCTGG - Intergenic
1203253802 22_KI270733v1_random:129595-129617 CCCGGTGGCGGCCCGGCGTCCGG + Intergenic
1203261858 22_KI270733v1_random:174674-174696 CCCGGTGGCGGCCCGGCGTCCGG + Intergenic
950495383 3:13330887-13330909 CCTGCTGGCTGACCCACGGCAGG - Intronic
950667544 3:14506369-14506391 CGAGGTGTCTGCCCCACATCCGG + Intronic
954433730 3:50484945-50484967 CATGGTGGCTGCCCCAGGGCTGG + Intronic
962868774 3:139470205-139470227 CCCGGTGACTTCCCCATTTCAGG + Intronic
965799550 3:172477511-172477533 CAAGGTGGCTGCCCCCTGTCTGG + Intergenic
968731272 4:2270465-2270487 CCTGGTGGCTGCCTCAGGGCAGG - Exonic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
984863878 4:184264024-184264046 CCCGGTGACTTCCCCACTACTGG + Intergenic
985705081 5:1395730-1395752 CTGGGTGGCAGCCCCACTTCAGG + Intronic
986410756 5:7476326-7476348 CCTGGTGGATCCCCCACGCCTGG + Intronic
986662516 5:10072027-10072049 CATAGTAGCTGCCCCACGTCTGG - Intergenic
992431662 5:76716259-76716281 CCGGGAGGCTGCCCCGCCTCGGG - Exonic
997577938 5:134997213-134997235 GCCGGAGGCTGCCCCTCGCCTGG + Intronic
997900847 5:137762891-137762913 ACAGGTGCCTGCCCCACGACTGG - Intergenic
1002050111 5:176565756-176565778 CCCTGTGTCTGCCCCATGTCAGG + Intronic
1006786180 6:36668859-36668881 GCCGGTGGCTGCCCTCCGTGTGG - Intergenic
1007927680 6:45663353-45663375 CCCGGAGGCCGCCCCGCGTCTGG + Intronic
1016435896 6:144036541-144036563 CCCGGTAGCAGCCCCAGGACTGG - Intronic
1019501155 7:1365332-1365354 CCTGGTGCCTGCCCCTTGTCTGG - Intergenic
1022543358 7:31160344-31160366 ACCAGGGGCTGCCCCAGGTCTGG - Intergenic
1022690050 7:32640807-32640829 ACAGGTGCCTGCCCCACGCCCGG + Intergenic
1024137330 7:46423638-46423660 CCCAGTGGGTTCCCCACCTCTGG + Intergenic
1025097334 7:56106438-56106460 TTCGGTGGTTGTCCCACGTCCGG - Exonic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1029275183 7:99399733-99399755 CCTGGTGGCTGCCAAAAGTCAGG + Intronic
1030082212 7:105787966-105787988 CCACGTGGCTGCCCCACCCCGGG - Intronic
1030890184 7:114990496-114990518 CCCTCTGCCTGCCCCACGACAGG + Intronic
1035185495 7:157122976-157122998 GCCAGGGGCTGCCCCGCGTCTGG - Intergenic
1036635699 8:10548420-10548442 CCCGGTGGCTGCCACCCTGCTGG + Intronic
1040138433 8:43882515-43882537 CCCCGTGGGTGCCCCTAGTCTGG + Intergenic
1049694395 8:143976442-143976464 CCCGGTTGCAGCCCCCCGCCCGG + Intronic
1053368769 9:37543060-37543082 TCCTGGGGCTGCCCCACGTGGGG - Intronic
1056386315 9:86099697-86099719 GCCGGTGGCCGCCCCTCGGCGGG + Intronic
1061516795 9:131094827-131094849 CCCGGCAGCGGCCCCACCTCTGG - Intergenic
1061673415 9:132202057-132202079 CCCGGTGGCTGCCTCATTTCTGG + Intronic
1061822610 9:133236864-133236886 CCCGAAGCCTGCCCCACGCCTGG + Intergenic
1062178020 9:135175140-135175162 CCTGGTGGCTGCCCCTCCTGGGG + Intergenic
1203470202 Un_GL000220v1:112743-112765 CCCGGTGGCGGCCCGGCGTCCGG + Intergenic
1203478023 Un_GL000220v1:156715-156737 CCCGGTGGCGGCCCGGCGTCCGG + Intergenic
1185464139 X:345329-345351 CCCAGTCGCTGCCCCGTGTCTGG - Intronic
1201147624 Y:11073448-11073470 CCACGTGGCAACCCCACGTCAGG + Intergenic