ID: 1084920258

View in Genome Browser
Species Human (GRCh38)
Location 11:72464032-72464054
Sequence AGTCATAAGACTCCCTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084920256_1084920258 21 Left 1084920256 11:72463988-72464010 CCAGTAGGAAAGTGTGAAAATCT No data
Right 1084920258 11:72464032-72464054 AGTCATAAGACTCCCTGTGATGG No data
1084920257_1084920258 -5 Left 1084920257 11:72464014-72464036 CCTCAACTTTTCATCTAAAGTCA No data
Right 1084920258 11:72464032-72464054 AGTCATAAGACTCCCTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084920258 Original CRISPR AGTCATAAGACTCCCTGTGA TGG Intergenic
No off target data available for this crispr