ID: 1084920804

View in Genome Browser
Species Human (GRCh38)
Location 11:72468323-72468345
Sequence CGGCTACTCACTTGTTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084920804_1084920811 14 Left 1084920804 11:72468323-72468345 CCAATAAAACAAGTGAGTAGCCG No data
Right 1084920811 11:72468360-72468382 CGCCTGAAATCCAGCACTTTGGG No data
1084920804_1084920814 23 Left 1084920804 11:72468323-72468345 CCAATAAAACAAGTGAGTAGCCG No data
Right 1084920814 11:72468369-72468391 TCCAGCACTTTGGGAGGCCGAGG 0: 4409
1: 129159
2: 271112
3: 210419
4: 128819
1084920804_1084920817 27 Left 1084920804 11:72468323-72468345 CCAATAAAACAAGTGAGTAGCCG No data
Right 1084920817 11:72468373-72468395 GCACTTTGGGAGGCCGAGGTGGG 0: 36192
1: 181118
2: 265840
3: 185597
4: 116247
1084920804_1084920810 13 Left 1084920804 11:72468323-72468345 CCAATAAAACAAGTGAGTAGCCG No data
Right 1084920810 11:72468359-72468381 ACGCCTGAAATCCAGCACTTTGG No data
1084920804_1084920813 17 Left 1084920804 11:72468323-72468345 CCAATAAAACAAGTGAGTAGCCG No data
Right 1084920813 11:72468363-72468385 CTGAAATCCAGCACTTTGGGAGG No data
1084920804_1084920818 30 Left 1084920804 11:72468323-72468345 CCAATAAAACAAGTGAGTAGCCG No data
Right 1084920818 11:72468376-72468398 CTTTGGGAGGCCGAGGTGGGTGG 0: 27130
1: 110883
2: 157143
3: 168159
4: 124493
1084920804_1084920816 26 Left 1084920804 11:72468323-72468345 CCAATAAAACAAGTGAGTAGCCG No data
Right 1084920816 11:72468372-72468394 AGCACTTTGGGAGGCCGAGGTGG 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084920804 Original CRISPR CGGCTACTCACTTGTTTTAT TGG (reversed) Intergenic
No off target data available for this crispr