ID: 1084924812

View in Genome Browser
Species Human (GRCh38)
Location 11:72502738-72502760
Sequence TCTCAGATGGGGCAGCTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6805
Summary {0: 20, 1: 340, 2: 723, 3: 1614, 4: 4108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084924803_1084924812 16 Left 1084924803 11:72502699-72502721 CCCAGATGGGGTGGCTGCCGGGC 0: 236
1: 870
2: 3957
3: 4312
4: 3171
Right 1084924812 11:72502738-72502760 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
1084924806_1084924812 -1 Left 1084924806 11:72502716-72502738 CCGGGCAGAGAGGCTCCTCACTT 0: 101
1: 7373
2: 8409
3: 5161
4: 5338
Right 1084924812 11:72502738-72502760 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
1084924800_1084924812 24 Left 1084924800 11:72502691-72502713 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 1084924812 11:72502738-72502760 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
1084924804_1084924812 15 Left 1084924804 11:72502700-72502722 CCAGATGGGGTGGCTGCCGGGCA 0: 30
1: 618
2: 2881
3: 3617
4: 2512
Right 1084924812 11:72502738-72502760 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084924812 Original CRISPR TCTCAGATGGGGCAGCTGCC GGG Intergenic
Too many off-targets to display for this crispr