ID: 1084925771

View in Genome Browser
Species Human (GRCh38)
Location 11:72510354-72510376
Sequence TGCCAGCTAAAGAACTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084925767_1084925771 5 Left 1084925767 11:72510326-72510348 CCACTGGCCACAACACTCCAATG No data
Right 1084925771 11:72510354-72510376 TGCCAGCTAAAGAACTTTGTTGG No data
1084925764_1084925771 21 Left 1084925764 11:72510310-72510332 CCACAGTGCTCCTGATCCACTGG No data
Right 1084925771 11:72510354-72510376 TGCCAGCTAAAGAACTTTGTTGG No data
1084925766_1084925771 11 Left 1084925766 11:72510320-72510342 CCTGATCCACTGGCCACAACACT No data
Right 1084925771 11:72510354-72510376 TGCCAGCTAAAGAACTTTGTTGG No data
1084925769_1084925771 -2 Left 1084925769 11:72510333-72510355 CCACAACACTCCAATGAGTGGTG No data
Right 1084925771 11:72510354-72510376 TGCCAGCTAAAGAACTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084925771 Original CRISPR TGCCAGCTAAAGAACTTTGT TGG Intergenic
No off target data available for this crispr