ID: 1084925959 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:72511401-72511423 |
Sequence | CTTTGAGAATGGATGGAAGT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1084925959_1084925963 | 1 | Left | 1084925959 | 11:72511401-72511423 | CCTACTTCCATCCATTCTCAAAG | No data | ||
Right | 1084925963 | 11:72511425-72511447 | CTTCCCTCTGAAGATCTGCTTGG | 0: 21 1: 57 2: 100 3: 103 4: 259 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1084925959 | Original CRISPR | CTTTGAGAATGGATGGAAGT AGG (reversed) | Intergenic | ||
No off target data available for this crispr |