ID: 1084925959

View in Genome Browser
Species Human (GRCh38)
Location 11:72511401-72511423
Sequence CTTTGAGAATGGATGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084925959_1084925963 1 Left 1084925959 11:72511401-72511423 CCTACTTCCATCCATTCTCAAAG No data
Right 1084925963 11:72511425-72511447 CTTCCCTCTGAAGATCTGCTTGG 0: 21
1: 57
2: 100
3: 103
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084925959 Original CRISPR CTTTGAGAATGGATGGAAGT AGG (reversed) Intergenic
No off target data available for this crispr