ID: 1084931964

View in Genome Browser
Species Human (GRCh38)
Location 11:72563003-72563025
Sequence GAACCATCATTGGCCCATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084931959_1084931964 26 Left 1084931959 11:72562954-72562976 CCTCAGGTGCAGAGGGCTGAGCT No data
Right 1084931964 11:72563003-72563025 GAACCATCATTGGCCCATACAGG No data
1084931960_1084931964 0 Left 1084931960 11:72562980-72563002 CCTACTCCTGAGTTCACAGCGTG No data
Right 1084931964 11:72563003-72563025 GAACCATCATTGGCCCATACAGG No data
1084931962_1084931964 -6 Left 1084931962 11:72562986-72563008 CCTGAGTTCACAGCGTGGAACCA No data
Right 1084931964 11:72563003-72563025 GAACCATCATTGGCCCATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084931964 Original CRISPR GAACCATCATTGGCCCATAC AGG Intergenic
No off target data available for this crispr