ID: 1084935245

View in Genome Browser
Species Human (GRCh38)
Location 11:72583437-72583459
Sequence GATGATGATGTACCACATGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084935245_1084935251 28 Left 1084935245 11:72583437-72583459 CCTTCATGTGGTACATCATCATC 0: 1
1: 0
2: 0
3: 10
4: 154
Right 1084935251 11:72583488-72583510 CCTCATTCACTTTTTTGTATAGG 0: 1
1: 0
2: 1
3: 21
4: 257
1084935245_1084935248 -8 Left 1084935245 11:72583437-72583459 CCTTCATGTGGTACATCATCATC 0: 1
1: 0
2: 0
3: 10
4: 154
Right 1084935248 11:72583452-72583474 TCATCATCTCATTGGCCAGGTGG 0: 1
1: 0
2: 2
3: 8
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084935245 Original CRISPR GATGATGATGTACCACATGA AGG (reversed) Exonic
907118797 1:51990920-51990942 GATGATAATGTAGCTGATGATGG + Intergenic
908482362 1:64554770-64554792 GATGATGATGTTCCATATTAGGG + Intronic
911859254 1:102927270-102927292 GATATTGAGGTCCCACATGAGGG - Intronic
912273971 1:108237520-108237542 GATTATGATCTACCAGATGAGGG - Intronic
912287296 1:108382342-108382364 GATTATGATCTACCAGATGAGGG + Intronic
912294248 1:108456803-108456825 GATTATGATCTACCAGATGAGGG + Intronic
913542754 1:119837562-119837584 GATTAAGATCTACCAGATGAGGG - Intergenic
915215451 1:154337487-154337509 GATGATGATGTAGGACCAGAAGG - Exonic
916381518 1:164217008-164217030 GATGTTGATGTACATCATCATGG - Intergenic
921968990 1:221124066-221124088 GTTGATAATGTGCCACATGCAGG + Intergenic
922867821 1:228875496-228875518 GATGATTATGTAGCTAATGATGG - Intergenic
924681070 1:246234329-246234351 GATGAACATGTACCACATGGAGG + Intronic
1062869817 10:890778-890800 GATGTTGAAGTAACACACGAGGG + Intronic
1064967666 10:21031224-21031246 GATGATGATGAACCCTATGGGGG + Intronic
1065863340 10:29890995-29891017 AATGAGGCTGTACCAAATGATGG + Intergenic
1070599910 10:77858234-77858256 AATGATGGTGGACCACATGTAGG + Intronic
1072847535 10:98848781-98848803 GATGAAAAAGTACCACATGCAGG + Intronic
1072863914 10:99037705-99037727 GATAATGTTCTACGACATGAGGG + Intronic
1079188923 11:18261516-18261538 GATGATGAGGTACGAGAGGAAGG + Intergenic
1079400875 11:20105478-20105500 GATGATGGTGATCCAAATGATGG - Intronic
1079719240 11:23789581-23789603 GATGATAATGTAGCACATTTTGG - Intergenic
1081921132 11:46778502-46778524 GATGGAGATGAACCAGATGACGG - Exonic
1084935245 11:72583437-72583459 GATGATGATGTACCACATGAAGG - Exonic
1085921707 11:80965260-80965282 GATGATGATTTCCCACATCTTGG + Intergenic
1086276442 11:85135027-85135049 TGTGATGATGTAACAAATGAGGG - Intronic
1088182566 11:107128801-107128823 GAAGAAGATGTTCCAGATGAAGG - Intergenic
1088266474 11:107992542-107992564 GATGATTCTGTACCACAGAAGGG - Intergenic
1090203975 11:124874944-124874966 GATGATTATGAGGCACATGAGGG + Intronic
1091234930 11:134015132-134015154 GTTTTTGATGTACAACATGATGG - Intergenic
1092156494 12:6285188-6285210 GATTATGATCTACCACCAGAGGG - Intergenic
1096249262 12:50017354-50017376 GATTATGTTGTACCACATTCTGG + Intronic
1098029300 12:66237721-66237743 GATAATGATTTCCCACATGCAGG + Intronic
1099966814 12:89455598-89455620 GTTGAAGATGTCCTACATGAAGG - Intronic
1100819039 12:98414000-98414022 CATGAAGTTTTACCACATGAAGG - Intergenic
1105400674 13:20091977-20091999 GATGAAGATGTAGGACTTGATGG + Intergenic
1109830031 13:67773515-67773537 GATGATGATGTAGCAAGAGAAGG - Intergenic
1110612115 13:77500663-77500685 GCTGTTGATGTACAAAATGATGG - Intergenic
1111708867 13:91785819-91785841 GATGATAGTGTATCACATCAGGG - Intronic
1112863271 13:103861987-103862009 GATGGTGATGTAGGGCATGAGGG - Intergenic
1113940282 13:114015243-114015265 GAAGAAGATGTCACACATGACGG + Exonic
1115132350 14:30068636-30068658 GAAGAATATGTACAACATGAAGG - Intronic
1118257238 14:64215759-64215781 GCTGATGATTTGCCACAGGAGGG + Intronic
1120578210 14:86210757-86210779 AATGTTGAAATACCACATGAAGG + Intergenic
1120687893 14:87559647-87559669 GATGATGCTCTCCCACATTATGG + Intergenic
1121382633 14:93487068-93487090 GATGATGAAGTTACACGTGAAGG + Intronic
1123208238 14:106734777-106734799 GACTGTGATGTACCACATGCAGG + Intergenic
1124181118 15:27475512-27475534 GATGATGATGGTCATCATGATGG + Intronic
1124824318 15:33078366-33078388 TAAAATGATGTACCACATGGAGG - Intronic
1130075854 15:80689455-80689477 GATGATGATGAACAATATCATGG - Intronic
1130122783 15:81065864-81065886 GATCATTTTATACCACATGAAGG - Intronic
1130784925 15:87085526-87085548 GATGATGCTGGTCCACATGGTGG + Intergenic
1131915787 15:97264643-97264665 GATGAGAATGTACCACAAAATGG - Intergenic
1135166349 16:20142561-20142583 GAAGATGATTTAGAACATGAAGG + Intergenic
1135282077 16:21160469-21160491 GATGATGATGTATGGAATGATGG + Intronic
1136705327 16:32183302-32183324 GATTATGATGTGCCTCATCATGG - Intergenic
1136762585 16:32746105-32746127 GATTATGATGTGCCTCATCATGG + Intergenic
1136805514 16:33124281-33124303 GATTATGATGTGCCTCATCATGG - Intergenic
1138416604 16:56875198-56875220 GAGGATGCTGTCCCACAGGATGG - Intronic
1140741846 16:77948394-77948416 GATGATGGTGTTGCAAATGAGGG - Intronic
1203064742 16_KI270728v1_random:1006424-1006446 GATTATGATGTGCCTCATCATGG + Intergenic
1149456558 17:56793010-56793032 GATGATGATGAAGAACAAGAAGG + Intronic
1150037808 17:61822951-61822973 GATCATGAAGTACCCCAGGATGG + Intronic
1150091987 17:62334585-62334607 GATGATGATGAACCTCAAGTGGG - Intergenic
1153571194 18:6475237-6475259 GAGGATGATGTTCCACAAGAGGG - Intergenic
1157510798 18:48272039-48272061 GCTCATGATGCACCTCATGATGG + Intronic
1161841378 19:6683080-6683102 GATGAAGATGTCCCAGAGGAAGG + Intronic
1164126800 19:22325828-22325850 GATGAGTTTGTACCACTTGACGG - Intergenic
1165991991 19:39821150-39821172 GATGATGCTGTACTAAATGGAGG - Intergenic
927391353 2:22598956-22598978 GATGATGATGAAGGCCATGAAGG + Intergenic
928810565 2:35219410-35219432 GATGAAGACGTTCCACAGGATGG + Intergenic
929917847 2:46151091-46151113 GGTGCTGATGTACGAGATGATGG + Exonic
934154359 2:89182091-89182113 TATGAGGAGGTGCCACATGATGG - Intergenic
934161578 2:89254457-89254479 GCTGATGATTTACAACATCAAGG - Intergenic
934205706 2:89927958-89927980 GCTGATGATTTACAACATCAAGG + Intergenic
934212872 2:89999849-89999871 TATGAGGAGGTGCCACATGATGG + Intergenic
937245142 2:120487668-120487690 GATGATGATATGCCACACGAAGG + Intergenic
937440889 2:121914844-121914866 GATGATTATGTAACACACAAAGG - Intergenic
940549864 2:155140171-155140193 GAGGATGATGTACCCAAAGAGGG + Intergenic
940781832 2:157941452-157941474 GATGATTATGTACCATGAGAGGG + Intronic
941869185 2:170365942-170365964 TATGCTGATGTTCCACAGGAAGG - Intronic
948094654 2:235324157-235324179 TATGAGGATGTGCCATATGAGGG - Intergenic
1170665362 20:18381658-18381680 GAAGATGCTGTACCACAGCAGGG - Intergenic
1172821054 20:37734728-37734750 GCTGATGATGTAGCACAAAAAGG - Intronic
1173990492 20:47298868-47298890 GTTGATGTTGTACCGCAGGATGG - Exonic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1178508981 21:33186423-33186445 GATGAAGATGTAACAGAAGATGG + Intergenic
1180235265 21:46455363-46455385 GACGATCATATTCCACATGAAGG - Intergenic
1180689803 22:17703963-17703985 TATGATGATGTAGTACATCAAGG + Intronic
1180937312 22:19634244-19634266 CATGATGAAGTACCACAGGCTGG - Intergenic
949514241 3:4792847-4792869 AATTAAGATGTACCACTTGAAGG + Intronic
949840032 3:8310485-8310507 AATTAAGGTGTACCACATGATGG - Intergenic
950687833 3:14631523-14631545 GAGGATGCTGAACCACATGGAGG - Intergenic
954751701 3:52817688-52817710 CATGAGGATGTTCCAGATGATGG - Intronic
954764986 3:52907277-52907299 GATGAGGATGACCCAGATGAAGG - Exonic
957365347 3:79215297-79215319 GATGCTCATGTCCCACATGTGGG + Intronic
960945102 3:122961047-122961069 GCTGATGATGCCCCAGATGAGGG + Intronic
963658978 3:148100216-148100238 GTTAATGATGTTCCACAGGAAGG - Intergenic
964474300 3:157084710-157084732 GATGGTGATCTAGCCCATGAAGG - Intergenic
969430342 4:7150320-7150342 GGGGCTGATGTACCACAGGACGG + Intergenic
970520495 4:16879123-16879145 GATATAGATGTACCAAATGAGGG + Intronic
971203561 4:24537321-24537343 GGTGTTGATGTACCAAATCAAGG - Intronic
976096000 4:81509022-81509044 AATGATGATGTAGCAAATGAGGG + Intronic
978635766 4:110803726-110803748 CATGATGATGTGCCAAATAAAGG + Intergenic
979297815 4:119052990-119053012 GATGATGATATAACCCATGGTGG + Intronic
980332409 4:131426648-131426670 GGTGATGATGTACAACCTGGAGG - Intergenic
982859032 4:160425392-160425414 GATTATAATGTGCCATATGATGG - Intergenic
983519539 4:168692862-168692884 GATGATGATTTATCAAATGTAGG + Intronic
983758626 4:171376087-171376109 GATAATGATAAGCCACATGAAGG - Intergenic
987052821 5:14162197-14162219 GATGAGGATGTGCTCCATGAAGG + Intronic
991173799 5:63661084-63661106 GATGATTGTGTGCCACCTGAAGG + Intergenic
992082766 5:73250865-73250887 GATGGTGATGGACCAAATAAAGG + Intergenic
995882979 5:116863355-116863377 AATGCTGATTTACCAGATGAGGG - Intergenic
998267668 5:140678218-140678240 GATGATGAAGTAGAAAATGAAGG - Intronic
998423233 5:142006271-142006293 GAAGAAGTTGTTCCACATGAAGG + Exonic
999402753 5:151279262-151279284 CATGATAATGCACCATATGATGG - Intronic
1000640309 5:163694580-163694602 GATGATGATGTACCAGACACTGG + Intergenic
1000771538 5:165361067-165361089 GAAGATGAGGTAAAACATGAAGG - Intergenic
1001187779 5:169592585-169592607 GATGATTATATATTACATGAAGG - Intronic
1001428695 5:171642702-171642724 GATGATGATGTAGAAGATGGTGG - Intergenic
1001884429 5:175276341-175276363 GATACTGATGGACCACATGTGGG + Intergenic
1001932609 5:175683946-175683968 GATGATGAAGGCCCCCATGACGG - Exonic
1008130435 6:47714769-47714791 GATGATGAAGTCCCGAATGATGG + Exonic
1008509436 6:52262501-52262523 TATGATTATATACCAAATGAGGG - Intergenic
1012676486 6:102119315-102119337 GATGATGATGGTCCACATTGAGG - Intergenic
1013342392 6:109227734-109227756 CATGATGGAGTAACACATGAGGG + Intergenic
1013975428 6:116072618-116072640 GATGACAATGTTCCAGATGAGGG + Intergenic
1014803209 6:125800307-125800329 GAAGTTCATGTACCACATGAAGG + Intronic
1016096237 6:140041170-140041192 GATGATTATGTAACACATAAAGG - Intergenic
1016511274 6:144846069-144846091 GATGATCATGTAGCAAAAGAGGG + Intronic
1019183558 6:170208053-170208075 GAGGATGATATGCCACATGGGGG - Intergenic
1022196974 7:28078184-28078206 GATGATAATGTACCACTTACGGG + Intronic
1022817513 7:33927810-33927832 GAAGATGATGAACCACATTTTGG - Intronic
1024184152 7:46931696-46931718 GTTGATGATGTAGCCTATGATGG - Intergenic
1024531814 7:50399979-50400001 AATGATGAAGTCCCACGTGATGG + Exonic
1027732032 7:81886438-81886460 GATGATTATGTGCCACAGCAGGG + Intergenic
1028478849 7:91282391-91282413 CATTATGATGAACCATATGAAGG - Intergenic
1028654189 7:93184112-93184134 GATGAGGATGAAGCACTTGATGG - Intergenic
1030054318 7:105569239-105569261 GATGAAGATTTACAAGATGATGG - Exonic
1031347571 7:120687677-120687699 GTTTATTATGTACAACATGATGG - Intronic
1032557112 7:132847906-132847928 CATGACTATGTAACACATGAGGG + Intronic
1033619864 7:143052447-143052469 GATGATGGTGTTTCCCATGAAGG - Exonic
1034569627 7:151944794-151944816 GATGATCAGATCCCACATGATGG + Intergenic
1035484053 7:159208652-159208674 GAGGATGATGTCGTACATGATGG - Intergenic
1035484071 7:159208773-159208795 GAGGATGATGTCATACATGATGG - Intergenic
1035484089 7:159208894-159208916 GAGGATGATGTCGTACATGATGG - Intergenic
1035484096 7:159208934-159208956 GAGGATGATGTCGTACATGATGG - Intergenic
1035484103 7:159208974-159208996 GAGGATGATGTTGTACATGATGG - Intergenic
1035484107 7:159209014-159209036 GAGGATGATGTCATACATGATGG - Intergenic
1035653679 8:1289086-1289108 AATGCTGATGTACTCCATGAAGG + Intergenic
1036187307 8:6635049-6635071 GATGATGATGAACCAGGTGGTGG + Intronic
1042467999 8:69150472-69150494 GAGAATGATGTACAAAATGAAGG - Intergenic
1045528902 8:102965355-102965377 GATGATGATGAACAACAAGGAGG - Intronic
1045702431 8:104882100-104882122 GATGATAATGTCCCAGATGGTGG + Intronic
1046063507 8:109168511-109168533 GATGATAATCTACCTGATGATGG - Intergenic
1046933159 8:119861442-119861464 TATGATGATCTACTACATGCTGG - Intergenic
1052524289 9:29593684-29593706 GATGAAGAGATACCACATTATGG + Intergenic
1052810199 9:33051470-33051492 GTTAATGATGTACCAAATGCAGG + Intronic
1057244474 9:93443048-93443070 GATGAAGATGTTCCAGAGGAAGG + Intergenic
1057772530 9:97981665-97981687 ACTGATGATGTAGCACAAGATGG + Intergenic
1189941781 X:46131194-46131216 GATGAAAATGTACAACATGCTGG - Intergenic
1193857161 X:86617621-86617643 GCTTAACATGTACCACATGAAGG - Intronic
1195573696 X:106425450-106425472 GCAGATGATGTACCAAATAAAGG - Intergenic
1198614573 X:138442264-138442286 GGTGATGAGGTATCACATTAAGG + Intergenic
1198701967 X:139406510-139406532 GATGATTATGTTCCCCAGGATGG + Intergenic
1199429687 X:147745178-147745200 GCTGAGGGTGTACCACATGCAGG - Intergenic