ID: 1084935818

View in Genome Browser
Species Human (GRCh38)
Location 11:72586112-72586134
Sequence GGTGCTGGTGAGCACGGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 356}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084935814_1084935818 -7 Left 1084935814 11:72586096-72586118 CCTTCTGGAAGGCCAGGGTGCTG 0: 1
1: 0
2: 4
3: 32
4: 295
Right 1084935818 11:72586112-72586134 GGTGCTGGTGAGCACGGTGCTGG 0: 1
1: 0
2: 4
3: 21
4: 356
1084935809_1084935818 20 Left 1084935809 11:72586069-72586091 CCTGGCACTCACACTTGAGTTTC 0: 1
1: 0
2: 2
3: 11
4: 143
Right 1084935818 11:72586112-72586134 GGTGCTGGTGAGCACGGTGCTGG 0: 1
1: 0
2: 4
3: 21
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084935818 Original CRISPR GGTGCTGGTGAGCACGGTGC TGG Exonic
900032347 1:380881-380903 GGAGCTGGTGAGCAGAGGGCTGG - Intergenic
900052898 1:609067-609089 GGAGCTGGTGAGCAGAGGGCTGG - Intergenic
900151583 1:1181295-1181317 GGTGACGGTGGGCACGGTGTGGG - Intronic
900265064 1:1753239-1753261 GGTCCTGGAGGGGACGGTGCAGG + Intronic
900496372 1:2977830-2977852 GGTGCTGGTGTGGATGGTGGGGG + Intergenic
901127104 1:6937344-6937366 GGTGATGGTGATGACGGTGGTGG - Intronic
901932911 1:12608411-12608433 GGTGCTGGGGAGCAGGGAGGAGG - Intronic
902140013 1:14345587-14345609 GGGGCTGGTGTGCACTGAGCTGG - Intergenic
902413917 1:16227906-16227928 GGAGGAGGTGAGCACGGAGCCGG - Intergenic
902786629 1:18736892-18736914 GCTGCTGGTGGCCACTGTGCTGG + Intronic
903283664 1:22264208-22264230 GGTGCTGGTGACAGTGGTGCTGG + Intergenic
903460985 1:23520983-23521005 GGAGCTGATGAACACGGAGCAGG - Exonic
903759150 1:25685568-25685590 GCAGCTGGGGAGCAAGGTGCTGG + Intronic
903769240 1:25753649-25753671 GGTGCTGGTGAGGAGGCTCCAGG + Intronic
904037292 1:27565563-27565585 GGCGCTGGTGAGCAAGGGGCGGG + Intronic
904421528 1:30397641-30397663 GGTCCTGGTGAGGACCGTGGAGG - Intergenic
905866429 1:41379509-41379531 GGGGCTGGGGAGCCAGGTGCAGG + Intronic
906831178 1:49033508-49033530 CGTGCTGGTCAGAACTGTGCTGG + Intronic
907324528 1:53628366-53628388 GATGCTGGTGTTCAGGGTGCTGG - Intronic
912203134 1:107480792-107480814 GCTGCTGCTGACCACGCTGCTGG + Exonic
915625068 1:157109429-157109451 GGTGGAGGTGAGCAAGGGGCAGG - Intergenic
916407993 1:164516391-164516413 GGTGATGGTGAACAAGTTGCTGG + Intergenic
918326252 1:183413417-183413439 ACTGCTGGAGAGCACGGTGGTGG + Intronic
919800454 1:201350958-201350980 GGTGCTGGAGAGAACGGTGTGGG + Intergenic
920293912 1:204944279-204944301 AGTGCTGGGGAGCAGGGAGCAGG + Exonic
922897057 1:229108689-229108711 GGTGCTGGTGTGCACTGTGCAGG - Intergenic
923038241 1:230300575-230300597 GCTGATCATGAGCACGGTGCTGG + Intergenic
923400856 1:233614503-233614525 TGTGGTGGAGAGCACGGTGCTGG - Exonic
1063005425 10:1965611-1965633 GGTGCTGGGGCGCATGGTGGAGG + Intergenic
1063983216 10:11473276-11473298 GGTGCTGGTGAGGCAGGAGCCGG + Intronic
1064179384 10:13101017-13101039 GGATCTGGTTAGCAAGGTGCAGG + Intronic
1065854284 10:29816979-29817001 GATGCTGGGGCGCAGGGTGCTGG + Intergenic
1066208959 10:33217531-33217553 GGTACAGGTCAGCCCGGTGCAGG + Intronic
1067063069 10:43088056-43088078 GGTGATGGTGAAGACGGTGGTGG + Intronic
1067063095 10:43088188-43088210 GGTGATGGTGAAGACGGTGGTGG + Intronic
1067227290 10:44384522-44384544 GGTCCTGCTGCGCACAGTGCTGG - Intronic
1067552543 10:47245802-47245824 GGTGCTGGTTTGCCTGGTGCGGG - Intergenic
1067706278 10:48608557-48608579 GGTGCTGGTGACCCCTGGGCAGG - Intronic
1068669334 10:59708841-59708863 GGTCCAGGTGGGCGCGGTGCCGG + Intronic
1070760151 10:79019048-79019070 GGTCATGGTGATCACGGTGTTGG - Intergenic
1075253233 10:120901496-120901518 GGTGCTGGTGTGCACAGGTCTGG + Intronic
1075430347 10:122374955-122374977 GGTGCTGGTGAGTGCGGAGCCGG + Intronic
1075521309 10:123145255-123145277 GATGGTGGTGGGCACGGGGCTGG - Intergenic
1076502618 10:130949289-130949311 GGTGATGGAGAGCAGGCTGCTGG - Intergenic
1077117591 11:892261-892283 GGTGCTGGTGGGCAGGGGCCTGG - Intronic
1077187784 11:1243182-1243204 GGTGGTGGTCAGCACTGTGGCGG - Exonic
1077188205 11:1244853-1244875 GGTGGTGGTCAGCACTGTGGGGG - Exonic
1077188740 11:1246953-1246975 GGTGGTGGTCAGCACTGTGGCGG - Exonic
1077189160 11:1248624-1248646 GGTGGTGGTCAGCACTGTGGGGG - Exonic
1077198861 11:1295592-1295614 GGGGCTGGTGCGCTCGGTGGGGG - Intronic
1077552456 11:3206866-3206888 GGTGATGGTGATGACGGTGGTGG + Intergenic
1077552480 11:3207031-3207053 GGTGATGGTGATGACGGTGATGG + Intergenic
1077552495 11:3207142-3207164 GGTGATGGTGAGGATGGTGATGG + Intergenic
1078088818 11:8251301-8251323 CAGGCTGGTGAGCACGGGGCTGG - Intronic
1079115808 11:17639904-17639926 GGTGATGGTGAGGATGGTGGTGG + Intronic
1079465557 11:20726420-20726442 GGTGCTAGTGACTAGGGTGCTGG - Intronic
1081202639 11:40236508-40236530 GGTGGTGGTGAGGAGGGTGCTGG - Intronic
1084113919 11:67030948-67030970 AGTGATGGGGAGCACGGGGCTGG - Intronic
1084642984 11:70436986-70437008 GGTGCTGGGGAGCTGGGTTCCGG + Intergenic
1084935818 11:72586112-72586134 GGTGCTGGTGAGCACGGTGCTGG + Exonic
1085471439 11:76760952-76760974 GGTGCTGATGGGCATGATGCTGG + Intergenic
1088258762 11:107925735-107925757 GGTGGTGGTGAGGATGGTGGGGG + Intronic
1089134298 11:116237028-116237050 GTTGATGGGCAGCACGGTGCAGG + Intergenic
1090592577 11:128288497-128288519 GGTGGTGGTGGCCCCGGTGCTGG - Intergenic
1091323106 11:134665395-134665417 GGTGCTGGGGTGCACGGCCCTGG + Intergenic
1091546502 12:1504662-1504684 GGTGCAGGTGAGGCGGGTGCGGG - Intergenic
1092289549 12:7150993-7151015 GGGGCTGGTGACCACGGTGCAGG - Exonic
1094822376 12:34236380-34236402 GGTGCTGATGATTACGGTGATGG - Intergenic
1095857114 12:46872567-46872589 GGTGGTGGTGAGCAGGGTTAGGG - Intergenic
1097383230 12:58920172-58920194 GCTGCTGCTGTGCGCGGTGCTGG - Exonic
1098678620 12:73321896-73321918 GGTGCTGGTGGACACAGTTCTGG - Intergenic
1101865521 12:108517053-108517075 GACGCTGCTGAGCATGGTGCTGG + Exonic
1102298766 12:111756567-111756589 AGAGCTGCTGAGCAGGGTGCAGG - Exonic
1104744021 12:131199480-131199502 GGTGATGGTGAGAATGGTGATGG - Intergenic
1104798894 12:131539817-131539839 GGTGATGGTGATCATGGTGATGG + Intergenic
1104977961 12:132560548-132560570 GGGGCAGGTGAGCGCGGCGCCGG - Intronic
1105207997 13:18239166-18239188 TGTGCTGGGGAGGAAGGTGCTGG - Intergenic
1111430092 13:88138138-88138160 AGTTCTGGTGAGCACAGTGATGG + Intergenic
1113292869 13:108925341-108925363 TGTGCTGCTGAGCACATTGCAGG + Intronic
1114409552 14:22487842-22487864 GGTTCTAATGAGCAGGGTGCAGG + Intergenic
1114670469 14:24408231-24408253 GCTGCTGCTGAGCCTGGTGCGGG + Exonic
1114678272 14:24460138-24460160 GGTGCTGGATAGCTCTGTGCTGG + Intergenic
1115478652 14:33840527-33840549 GGAGATGATGAGTACGGTGCAGG - Intergenic
1115636210 14:35292408-35292430 GGTGCTTGTGTGCCTGGTGCGGG + Exonic
1117051766 14:51867375-51867397 GGTGATGGTGAGCACAGTTTTGG - Intronic
1117555188 14:56876702-56876724 GGTGCTGGAAACCACTGTGCTGG + Intergenic
1117638768 14:57774994-57775016 AGTGCTGGTGGGGGCGGTGCTGG - Intronic
1117727294 14:58687305-58687327 GGTGCTGTGGAGCAGGGGGCAGG + Intergenic
1118846401 14:69550765-69550787 GGGGAGGGTGACCACGGTGCGGG + Intergenic
1119541808 14:75443759-75443781 GGTGGTGGTGAGGACGTGGCTGG + Intronic
1120835582 14:89035950-89035972 GGGACTGTTGAGCACCGTGCAGG + Intergenic
1122065967 14:99174784-99174806 GGCGCTGTTGAGCCCGGGGCTGG + Exonic
1122310244 14:100789721-100789743 GTTGCTGTTGAGCCTGGTGCTGG + Intergenic
1122718491 14:103709046-103709068 GGTGGTGGAAAGCTCGGTGCTGG - Intronic
1123466967 15:20524747-20524769 GGTGGTGGTGAGCCCAGTGAAGG + Intergenic
1123651147 15:22476295-22476317 GGTGGTGGTGAGCCCAGTGAAGG - Intergenic
1123741556 15:23285137-23285159 GGTGGTGGTGAGCCCAGTGAAGG - Intergenic
1123745441 15:23317421-23317443 GGTGGTGGTGAGCCCAGTGAAGG + Intergenic
1123853654 15:24384862-24384884 TGTGCTGGTGGGCCCGGGGCGGG - Intergenic
1123983466 15:25623853-25623875 GGGGCTGGTGATGAGGGTGCCGG - Intergenic
1124267543 15:28250306-28250328 GGTGGTGGTGAGCCCAGTGAGGG - Intronic
1124277713 15:28340738-28340760 GGTGGTGGTGAGCCCAGTGAAGG + Intergenic
1124304987 15:28570870-28570892 GGTGGTGGTGAGCCCAGTGAAGG - Intergenic
1126240612 15:46438801-46438823 GGTGGTTGTGAGGACGGTGAGGG + Intergenic
1127834551 15:62780240-62780262 GGTGATGGTGAGGATGGTGGTGG + Intronic
1127855971 15:62953808-62953830 GGTGCTGGCAACCAGGGTGCAGG + Intergenic
1129034077 15:72639355-72639377 GGGGCTGGTGAGCAGGGACCTGG + Intergenic
1129215805 15:74097861-74097883 GGGGCTGGTGAGCAGGGACCTGG - Intergenic
1129312511 15:74722572-74722594 GGTCCTGATAAGCACGTTGCAGG - Exonic
1129409001 15:75338594-75338616 GGGGCTGGTGAGCAGGGGCCTGG + Intronic
1129732942 15:77942194-77942216 GGGGCTGGTGAGCAGGGGCCTGG - Intergenic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1132390175 15:101433131-101433153 ACAGCTGGTGAGCACGGGGCTGG - Intronic
1132896755 16:2232902-2232924 CGTGCAGGTCAGCATGGTGCGGG + Exonic
1133286654 16:4693873-4693895 GGTGCTGGTGAGGACGGGCGAGG + Exonic
1133545036 16:6797951-6797973 GATGATGGTGATCACGGTGATGG + Intronic
1135539050 16:23316047-23316069 GGTGATGGTGAGGATGGTGATGG - Intronic
1135539076 16:23316200-23316222 GGTGATGGTGAGGATGGTGATGG - Intronic
1135539123 16:23316494-23316516 GGTGATGGTGAGGATGGTGATGG - Intronic
1135800358 16:25488754-25488776 GGTGCTGGCAGGCACGGGGCTGG + Intergenic
1136293771 16:29290567-29290589 GGTGCTGGGGAGGACGATGTGGG - Intergenic
1136394206 16:29984040-29984062 AGTGCTGGGGAGCCCTGTGCCGG + Intronic
1137247963 16:46720826-46720848 GGGGCTGCTGAGCGAGGTGCTGG - Intronic
1137932804 16:52604619-52604641 GGGGCTGGTGTCCACTGTGCAGG + Intergenic
1138349163 16:56337358-56337380 GGTGCTGGGGAGCAGTGTGTGGG + Intronic
1139358169 16:66379882-66379904 GATGGTGGTGATCACGGTGATGG + Intronic
1139358178 16:66379927-66379949 GTTGGTGGTGATCACGGTGATGG + Intronic
1139358187 16:66379972-66379994 GTTGGTGGTGATCACGGTGATGG + Intronic
1139358197 16:66380017-66380039 GGTGGTGGTGATCATGGTGATGG + Intronic
1139358206 16:66380062-66380084 GTTGGTGGTGATCACGGTGATGG + Intronic
1139358216 16:66380107-66380129 GGTGGTGGTGATCATGGTGATGG + Intronic
1139358225 16:66380152-66380174 GTTGGTGGTGATCACGGTGATGG + Intronic
1139358235 16:66380197-66380219 GGTGGTGGTGATCATGGTGATGG + Intronic
1139358245 16:66380242-66380264 GGTGGTGGTGATCACGGTGATGG + Intronic
1139593679 16:67946561-67946583 GGTGGTGGCCAGCAAGGTGCGGG - Exonic
1139876291 16:70148644-70148666 AGTGCTGGTGAACGCGCTGCTGG - Intronic
1140359498 16:74332484-74332506 AGTGCTGGTGAACGCGCTGCTGG + Intergenic
1141071085 16:80955019-80955041 GGTGCTGGTGAGGACAGGCCTGG - Intergenic
1141818864 16:86431569-86431591 GGAGCTGGGGAGCACAGTGAAGG + Intergenic
1141823631 16:86464237-86464259 GGTGCTGGTGATGACGATGATGG + Intergenic
1142118302 16:88372497-88372519 GGTGATGGTGATCATGGTGATGG - Intergenic
1143284904 17:5781704-5781726 GGGGCTGGTGAGAACAGTGGTGG + Intronic
1145302465 17:21650281-21650303 GGTGATGGTGAGGAAGGTGATGG + Intergenic
1145302475 17:21650362-21650384 GGTGAAGGTGAGCATGGTGATGG + Intergenic
1145302491 17:21650472-21650494 GGTGATGGTGAGGATGGTGATGG + Intergenic
1145302499 17:21650541-21650563 GATGCTGGTGAGAATGGTGAGGG + Intergenic
1145304240 17:21663972-21663994 GGTGATGGTGAGAATGGTGATGG + Intergenic
1145347807 17:22052651-22052673 GATGCTGGTGAGAATGGTGAGGG - Intergenic
1145347831 17:22052827-22052849 GGTGAAGGTGAGCATGGTGATGG - Intergenic
1145347847 17:22052961-22052983 GGTGAAGGTGAGCATGGTGATGG - Intergenic
1145347854 17:22053042-22053064 GGTGATGGTGAGGAAGGTGATGG - Intergenic
1145415769 17:22712597-22712619 GGTGATGGTGAGGATGGTGATGG + Intergenic
1145415779 17:22712666-22712688 GATGCTGGTGAGAATGGTGAGGG + Intergenic
1145777777 17:27541202-27541224 GGTGCTGGTGAGCTGGAAGCTGG + Intronic
1145960561 17:28884406-28884428 GGTCCTGGTGAGGAAGGTGGAGG + Intronic
1148218406 17:45846423-45846445 CAGGCTGGTGAGCAGGGTGCTGG - Exonic
1149494200 17:57106737-57106759 GGTGGTGGTGAGCCCTCTGCTGG - Exonic
1150229394 17:63541847-63541869 AGTGCTGTGGAGCAGGGTGCAGG - Intronic
1150304280 17:64071215-64071237 GGTGTTCCTGAGCAGGGTGCAGG + Intronic
1151164044 17:72189076-72189098 GGTGCTGGTGATGATGGTGGTGG + Intergenic
1152026067 17:77810189-77810211 GGTGGTGGTGATCATGGTGATGG + Intergenic
1152057595 17:78042793-78042815 GGTGTTGGTGATGACGGTGTTGG + Intronic
1152107372 17:78338568-78338590 GGTGCTGGTGAGCAGGTGACAGG + Intergenic
1152240785 17:79159935-79159957 GGTGCTGGGGAGAACTGTCCCGG - Intronic
1152352478 17:79791393-79791415 GGTGCGGGAGAGCAGAGTGCGGG - Intergenic
1152571522 17:81123249-81123271 GGTGCTGGCGTACACGGTCCGGG - Exonic
1155000850 18:21685245-21685267 GGTGCTGCTGAGCACTGTACAGG + Intronic
1158437078 18:57441338-57441360 GGCGCTGGTGAGCGCTCTGCTGG - Intronic
1160933366 19:1581202-1581224 GGTGCTAGTGTGCAGGGCGCTGG + Exonic
1161062069 19:2220171-2220193 GGTGCTAATGCCCACGGTGCTGG + Exonic
1161088056 19:2344161-2344183 GGGGCAGGGGAGCACGGTGTGGG - Intronic
1161139074 19:2637285-2637307 GGAGCAGGGGATCACGGTGCTGG + Intronic
1161272409 19:3397385-3397407 GGTGCCGGTGAGCAGGCCGCAGG + Intronic
1161481266 19:4511872-4511894 GGTGCCGGTCAGCACGGTCTTGG + Exonic
1161481324 19:4512169-4512191 GGTGCCGGTCAGCACGGTCTTGG + Exonic
1161961365 19:7525145-7525167 GATCCTGGTGGTCACGGTGCAGG + Exonic
1162183545 19:8887287-8887309 GGTGTTGGTAATCATGGTGCTGG - Intronic
1162932483 19:13963842-13963864 CGTGCAGGTGAGCGCGGGGCGGG - Exonic
1165490923 19:36122167-36122189 GGTGCAGGTGAGCAGAGCGCAGG + Intronic
1167103336 19:47417233-47417255 GGGGCTGGGGAGGCCGGTGCGGG + Exonic
1167394301 19:49217739-49217761 GATGCTGCTGGCCACGGTGCAGG + Intergenic
1167524995 19:49978091-49978113 GGTGCTGCTGACCACGGGGCCGG + Intronic
1168257623 19:55175306-55175328 GGAGCTGGGGGGCAGGGTGCTGG - Exonic
925033134 2:666733-666755 GGTCCTGGGGAGGACGGGGCTGG - Intergenic
925165033 2:1710722-1710744 GGTGCTGGTGGAGAGGGTGCTGG - Intronic
926112199 2:10190541-10190563 GGTGGTGGTGAGGATGGTGGTGG + Intronic
926751835 2:16204304-16204326 GGAGCTGGGGAGCTGGGTGCTGG + Intergenic
927721317 2:25384461-25384483 TGTGATGGAGAGCAGGGTGCTGG + Intronic
927880454 2:26686509-26686531 GCTACTGGTGAGCAGGCTGCAGG - Intergenic
927979361 2:27364459-27364481 GGATCTGGTGATCACGGAGCTGG - Exonic
929474213 2:42229396-42229418 GGTGCTTAAGAGCACAGTGCTGG - Intronic
933650500 2:84846526-84846548 CCTGCTGGTGAGCACAGTGGGGG - Intronic
934074824 2:88419221-88419243 CGTGGTGGTGGGCACGGTGGTGG - Intergenic
934557800 2:95296667-95296689 GGTGCTGGTCTGCAAGGTGCTGG - Intergenic
934702579 2:96453949-96453971 AGTGCTGCTGAGCAGTGTGCTGG - Intergenic
937884128 2:126888624-126888646 GGTGCTGGTGATCCCTGGGCAGG - Intergenic
940209088 2:151237833-151237855 GGTGCTGGTGAGTCAGGGGCTGG - Intergenic
940451337 2:153842018-153842040 GGTGGTGGGGAGCAGGGTGGAGG + Intergenic
941657127 2:168156140-168156162 GGTGCAGGTGGGCATGGTGGAGG + Intronic
942384984 2:175432977-175432999 GGTTTTGGTGAGGAAGGTGCAGG + Intergenic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
945144981 2:206728720-206728742 GAGGCTGGTTAGCACTGTGCAGG + Intergenic
947124347 2:226851608-226851630 GGTAGTGGTGAGCGAGGTGCAGG - Intronic
947758854 2:232588660-232588682 GGGGCTGGTGAGGATGTTGCAGG - Intergenic
947840437 2:233204323-233204345 GGCTTTGGTGAGCACGATGCTGG - Exonic
948047021 2:234952401-234952423 GGTGCTGGTGGGCAGGGACCCGG + Intronic
948700850 2:239758816-239758838 CGTGCAGGTGAGGACGCTGCTGG - Intergenic
1168773943 20:433136-433158 GGTGATCGTGGGCCCGGTGCAGG + Intergenic
1169836017 20:9880012-9880034 GGTGGTGGTTAGAAAGGTGCAGG + Intergenic
1170802836 20:19604442-19604464 GATGCTGGAGAGCAGGGTCCTGG + Intronic
1171252045 20:23656066-23656088 GCCGCTGGTGAGCACAGGGCAGG - Intergenic
1171519072 20:25761911-25761933 GGTGAAGGTGAGCATGGTGATGG + Intergenic
1171519084 20:25761986-25762008 GGTGATGGTGAGGATGGTGATGG + Intergenic
1171519092 20:25762056-25762078 GATGCTGGTGAGAATGGTGAGGG + Intergenic
1171555044 20:26074261-26074283 GGTGATGGTGAGAAAGGTGATGG - Intergenic
1171557832 20:26094435-26094457 GATGCTGGTGAGAATGGTGAGGG - Intergenic
1171557868 20:26094746-26094768 GGTGAAGGTGAGCATGGTGATGG - Intergenic
1172777259 20:37414904-37414926 GGTGCTGGTGAGAGCCATGCGGG - Intergenic
1172872456 20:38144190-38144212 GATCCAGGTGTGCACGGTGCTGG - Intronic
1172897936 20:38313750-38313772 GGTGATGGTGATGACGGTGATGG + Intronic
1175530385 20:59670879-59670901 GGTGCTGGTGAGCAACGCCCAGG - Intronic
1175604396 20:60300139-60300161 GGTGCTGGGTGGCCCGGTGCTGG - Intergenic
1175768659 20:61608736-61608758 GGTGGTGGTCAGCAGGCTGCAGG + Intronic
1176019809 20:62956890-62956912 GAAGCTGCTGAGCACGATGCCGG - Exonic
1176026108 20:62986426-62986448 GGTGCAGGTGGGCACTGTTCAGG + Intergenic
1176276052 20:64269982-64270004 AGTGCGGGTGTGCACGGTGTGGG + Intronic
1176653203 21:9568167-9568189 GGTGAAGGTGAGCATGGTGATGG + Intergenic
1176653230 21:9568343-9568365 GATGCTGGTGAGAATGGTGAGGG + Intergenic
1178520675 21:33286356-33286378 TGTGCTCGTGAGGGCGGTGCTGG + Intronic
1179308810 21:40178940-40178962 CGTGATGGTGAGCTCGTTGCTGG + Exonic
1180072391 21:45442911-45442933 GGTGCTGGTGTGGGCGGTGGTGG + Intronic
1180072424 21:45443043-45443065 GGTGCTGGTGTGGGCGGTGGTGG + Intronic
1180335607 22:11574441-11574463 GGTGCAGGTGAGCAAGCTGGCGG - Intergenic
1180758563 22:18181055-18181077 TGTGCTGGGGAGGAAGGTGCTGG - Intergenic
1180768850 22:18364847-18364869 TGTGCTGGGGAGGAAGGTGCTGG - Intergenic
1180777462 22:18497548-18497570 TGTGCTGGGGAGGAAGGTGCTGG + Intergenic
1180810182 22:18754858-18754880 TGTGCTGGGGAGGAAGGTGCTGG + Intergenic
1180826725 22:18868071-18868093 TGTGCTGGGGAGGAAGGTGCTGG - Intergenic
1181196326 22:21189110-21189132 TGTGCTGGGGAGGAAGGTGCTGG + Intergenic
1181213201 22:21304014-21304036 TGTGCTGGGGAGGAAGGTGCTGG - Intergenic
1181480768 22:23197907-23197929 GGGGATGGTGAGCGCTGTGCTGG + Intronic
1181509114 22:23381085-23381107 GATGCTGGTGATCATGGTGATGG + Intergenic
1181523852 22:23467001-23467023 GGTGCTGGGGAGGAAGGTGCTGG - Intergenic
1181893331 22:26084216-26084238 GGTGCAGGTGTGCAGGGGGCTGG + Intergenic
1182092143 22:27603015-27603037 GGTGATGGTGAGCTCGGTTTGGG + Intergenic
1183003788 22:34883358-34883380 GCTGCTGGTTGGCATGGTGCAGG - Intergenic
1184500355 22:44867889-44867911 GGTGCTGGTGGGCGCTGAGCTGG + Intergenic
1185060745 22:48605407-48605429 GGTGATGGTGAGGATGGTGGTGG + Intronic
1185136139 22:49073807-49073829 GGTGATGGTGAGCATGGTGATGG - Intergenic
1185172397 22:49301633-49301655 GTGGCTGGTGAGGACGGTGGAGG - Intergenic
1185250353 22:49798617-49798639 GGTGCTGCTGCGCTCAGTGCTGG - Exonic
1203230472 22_KI270731v1_random:105731-105753 TGTGCTGGGGAGGAAGGTGCTGG - Intergenic
1203276866 22_KI270734v1_random:93981-94003 TGTGCTGGGGAGGAAGGTGCTGG - Intergenic
950207467 3:11091986-11092008 GGTGGTGGTGGGCGAGGTGCAGG - Intergenic
950552465 3:13675075-13675097 GGTGCTGGTGAGGGCGGCTCTGG + Intergenic
952409507 3:33034509-33034531 GGTGCTGGTGGGCAGGCTGATGG - Intronic
953346065 3:42176659-42176681 GGTGGTGGTGAGTACATTGCGGG + Intronic
954314302 3:49792866-49792888 GGTGCTGGTGGCCACTGTGCTGG + Exonic
954316425 3:49804050-49804072 GGTGTTAGTGAGCACAGGGCAGG - Intronic
955089269 3:55733142-55733164 GGTGCAGGAGAGGAGGGTGCAGG + Intronic
961457375 3:127030934-127030956 GGTGTAGCTGTGCACGGTGCAGG - Intronic
961654119 3:128432361-128432383 GGTCCAGGTGAGCACGATGGCGG + Intergenic
961657980 3:128453757-128453779 GGTGCTGGGCAGCGCGGGGCTGG - Intergenic
961933076 3:130554467-130554489 GGTGCTGGTGGGCACGAGGCTGG + Intergenic
962452500 3:135532235-135532257 GGTCCTGGTGAGCTCGGTGTAGG + Intergenic
966906329 3:184528478-184528500 GGTGATGGTGAGGATGGTGGTGG + Intronic
968456660 4:703974-703996 GGTGCTGGGGTGCAAGGGGCAGG - Intergenic
968589991 4:1452949-1452971 GGTGGTGGTGAGGACGATGGTGG - Intergenic
969239526 4:5889420-5889442 GGGGCTGGTGTCCACAGTGCTGG - Intronic
969280892 4:6170247-6170269 GGTGGTGGTGAGAAGGGTGGGGG - Intronic
969529853 4:7724608-7724630 AGTGCTGGTGAGGATGGTGATGG + Intronic
969529887 4:7724780-7724802 GGTGCTGGTGAGGATGGTGATGG + Intronic
969676557 4:8617644-8617666 GTTGCTGCTGAGCCCCGTGCAGG + Intronic
969867421 4:10084864-10084886 GGTGCTGGTCGGCGGGGTGCAGG - Intronic
971328922 4:25666183-25666205 GGGGCTGGTGATCGGGGTGCTGG + Exonic
973218419 4:47697791-47697813 GGTGCTGCTGGGCACTGTGCTGG + Intronic
979608450 4:122665206-122665228 GGTGCTGGTGAATTCGGTGATGG - Intergenic
985471278 5:48439-48461 GCGGCTGGAGAGCAGGGTGCAGG + Intergenic
985879258 5:2626277-2626299 GGTGCTGGTCAGGATTGTGCTGG - Intergenic
985949057 5:3209486-3209508 TGTCCAGGGGAGCACGGTGCAGG - Intergenic
986029235 5:3880139-3880161 GGTTCTGGGCAGCATGGTGCTGG + Intergenic
989400117 5:40999714-40999736 GGTGCTGGTGAAGAAGGTGAAGG + Exonic
991486263 5:67140247-67140269 GGAGGTCGTCAGCACGGTGCGGG - Intronic
992769651 5:80035346-80035368 GGTGCTGGGGAGCTGGCTGCTGG - Exonic
995650388 5:114362289-114362311 GCTGCTGGTGCGCGAGGTGCGGG - Exonic
1001121455 5:168984242-168984264 AGTGCTGGTGAGCACGGGTAGGG + Intronic
1001424225 5:171612982-171613004 GGTGCTGGTGACCAAGGGCCAGG - Intergenic
1001753304 5:174147717-174147739 GGTCCTGCTGAGCATGGTGCAGG - Intronic
1002179818 5:177425625-177425647 GGTGCTGGAGAACACAGTGATGG - Intronic
1002741473 5:181437987-181438009 GGAGCTGGTGAGCAGAGGGCTGG + Intergenic
1003105010 6:3208726-3208748 GGGGCTGGTCAGCAGGGAGCAGG + Intergenic
1003722249 6:8717015-8717037 TGTGATGGTGAGCACGGGGAAGG - Intergenic
1004272239 6:14205924-14205946 GGAGCTCGTGAGCACTCTGCAGG + Intergenic
1007235999 6:40391942-40391964 GGTGATGGAGAGCACGGTCTAGG - Exonic
1007707261 6:43798495-43798517 GGTGATGGTGGGCACAGTGGAGG - Intergenic
1007709663 6:43814314-43814336 GGTGCTGGCGGGCAGGGTGGAGG - Intergenic
1008201023 6:48591170-48591192 GGGGCTGGTGAGCAAGGGGAGGG - Intergenic
1012310723 6:97721069-97721091 AGTGATGGTGATCATGGTGCAGG + Intergenic
1014094725 6:117447333-117447355 GGTGCTGGTTATCACAGTACTGG - Intronic
1014574952 6:123058487-123058509 GGTGCAGCTGAGCAGAGTGCAGG - Intronic
1017672107 6:156778187-156778209 GGTGGTGGTGGGCATGGTGGTGG - Exonic
1018795009 6:167179116-167179138 GTTGCTGGTGAGCAGGGTAGGGG + Exonic
1018821309 6:167375950-167375972 GGAGCTGGTGAGCAGGGTCGAGG - Exonic
1018893444 6:167997606-167997628 GGTGCTGGTGAGGAAGGGGCAGG - Intronic
1018933875 6:168260724-168260746 GGTGCCGGTCAGCCCTGTGCAGG - Intergenic
1019010588 6:168841199-168841221 GGTGCTGATGAGGACGGCGAAGG + Intergenic
1019246607 6:170713752-170713774 GGAGCTGGTGAGCAGAGGGCTGG + Intergenic
1019417243 7:933474-933496 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417254 7:933504-933526 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417270 7:933541-933563 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417301 7:933631-933653 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417312 7:933661-933683 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417323 7:933691-933713 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417354 7:933781-933803 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417395 7:933901-933923 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417416 7:933961-933983 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417427 7:933991-934013 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417455 7:934081-934103 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019417466 7:934111-934133 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417487 7:934171-934193 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417498 7:934201-934223 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417526 7:934291-934313 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019685529 7:2379919-2379941 GGGGCTGGGGAGCAGAGTGCGGG + Intronic
1019706780 7:2500537-2500559 GGTGATAGTGACCAGGGTGCAGG - Intergenic
1022310725 7:29194262-29194284 GGTGCTGGGGAGGCCGGGGCCGG - Intronic
1023680732 7:42684745-42684767 GGTGCTGGTGAGGACTAGGCAGG + Intergenic
1025279547 7:57616838-57616860 GGTGAAGGTGAGCATGGTGATGG + Intergenic
1025279571 7:57617014-57617036 GATGCTGGTGAGAATGGTGAGGG + Intergenic
1025305160 7:57848486-57848508 GATGCTGGTGAGAATGGTGAGGG - Intergenic
1025305184 7:57848662-57848684 GGTGAAGGTGAGCATGGTGATGG - Intergenic
1025908466 7:65808455-65808477 GGTGCTGCTGAGCACCGTGCAGG - Intergenic
1025980617 7:66402283-66402305 GGTGCTGCTGAGCACCGTGCAGG + Intronic
1026848129 7:73708932-73708954 GGAGCTGCTGAGCCAGGTGCAGG + Intronic
1026883526 7:73922242-73922264 GCTGCTGGCGAGCCCGATGCTGG + Intergenic
1027205505 7:76094652-76094674 GATGCTGCTGAGCACTGTGCAGG + Intergenic
1032237264 7:130136144-130136166 GGAGCTGCTGAGCCCTGTGCAGG + Intergenic
1032403223 7:131638104-131638126 GGTGCTGATGAGCAGGGCGGGGG + Intergenic
1033050687 7:138001678-138001700 GGTGCTGGAGAGCGGGGAGCAGG - Exonic
1033168682 7:139064509-139064531 GGTGCTGGTGACTACGGTAGAGG - Intronic
1033571016 7:142628143-142628165 GGTGCTGGTGAGCTGGCTCCTGG + Intergenic
1034436436 7:151064761-151064783 GGTGCAGGTGCGCTGGGTGCGGG + Exonic
1035038719 7:155912022-155912044 GGTGCAGGAGGGCATGGTGCTGG - Intergenic
1035501532 8:94209-94231 GGAGCTGGTGAGCAGAGGGCTGG - Intergenic
1035529839 8:342578-342600 GGTGCCAGTGAGGACGCTGCAGG + Intergenic
1035918492 8:3651706-3651728 GTTGCTGGTAAGCACTGTGATGG - Intronic
1036184530 8:6612497-6612519 GGTGCTGAAGAGCACGGGTCGGG - Intronic
1037181517 8:16012529-16012551 GCTGCTGGTGGGGACGGTGGTGG + Intergenic
1038808081 8:30812698-30812720 GGTGCCGGGGAGCGCGGCGCGGG + Exonic
1040548415 8:48420006-48420028 GGTGCTGCTGAACACGGAGAGGG - Intergenic
1044321528 8:90807558-90807580 GGGTCTGGAGAGCACAGTGCGGG - Intronic
1045555771 8:103213354-103213376 GTTGATGGTGAGGACTGTGCTGG + Intronic
1049291722 8:141806873-141806895 GGTGCTGCAGAGCTGGGTGCTGG + Intergenic
1049845379 8:144798571-144798593 GGGGTTGGGGAGCACGGTGGGGG - Intergenic
1050091200 9:2017201-2017223 GATGGTGGTGAGCGCGGGGCTGG + Intronic
1053138220 9:35665025-35665047 GGGGCTGGTGGCCACGGTGGGGG - Exonic
1053173649 9:35907674-35907696 GGTGCTGGGGTGCAGGGTGTTGG + Intergenic
1055248727 9:74277009-74277031 GGTGCTGGTGACCATGGTGATGG - Intergenic
1056765626 9:89442992-89443014 CCTGCTGCTGAGCACGGTCCTGG - Intronic
1057193437 9:93100038-93100060 GGGGCTGGGGACCACGGTGATGG - Intronic
1057799378 9:98180867-98180889 GGTGTTGCTGAGCATGGTGGTGG - Intronic
1058315017 9:103554374-103554396 GATGCTGGTGAGGATGGTGCTGG - Intergenic
1060234579 9:121853432-121853454 GGTGGTGGTGAGCAAGGAGAGGG + Intronic
1060412197 9:123407170-123407192 GGGGGTGGGGAGCACGGAGCTGG + Intronic
1060552329 9:124491511-124491533 GGTGCTGCTGGGCCTGGTGCTGG - Intronic
1061226719 9:129284787-129284809 GGGGCAGGTGTGCACGGAGCAGG - Intergenic
1061582363 9:131545830-131545852 GGTGCTGGTGGGGCGGGTGCTGG + Intergenic
1061903781 9:133686200-133686222 GGTGCTGGGTACCACGGAGCAGG - Intronic
1062584419 9:137242548-137242570 GGAGCTGGTGGACTCGGTGCTGG + Exonic
1203607384 Un_KI270748v1:69203-69225 GGAGCTGGTGAGCAGAGGGCTGG + Intergenic
1203630923 Un_KI270750v1:71617-71639 GGTGAAGGTGAGCATGGTGATGG + Intergenic
1203630950 Un_KI270750v1:71793-71815 GATGCTGGTGAGAATGGTGAGGG + Intergenic
1185499469 X:585690-585712 GGAGCTGGGGCGCCCGGTGCAGG - Intergenic
1190288539 X:48976388-48976410 GGTGGTGCTGAGCCCGGGGCTGG - Intronic
1191995350 X:67089340-67089362 GGTGCTAGTGATCATGGTGGTGG + Intergenic
1197612316 X:128653223-128653245 GATGCTCATGAGCAAGGTGCTGG - Intergenic
1197859014 X:130949844-130949866 GGGGCTAGTGAGCACAGTCCTGG + Intergenic
1200154116 X:153966291-153966313 GGTGCTGGAGAGCGGGGTGGGGG - Intronic
1201143567 Y:11048440-11048462 GGTGATGGTGATAACGGTGATGG + Intergenic
1201373097 Y:13286569-13286591 GGTGCTTGTGTGCCTGGTGCGGG + Intronic
1201768427 Y:17594684-17594706 GGTGCTGGTGATTATGGTGATGG - Intergenic
1201833127 Y:18311301-18311323 GGTGCTGGTGATTATGGTGATGG + Intergenic
1202115361 Y:21466132-21466154 GGCCCTGGTGTGCAGGGTGCTGG + Intergenic